roc model psychiatric evaluation stabilization and restoration of competency in a jail setting
Báo cáo khoa học: "Ionizing radiation and inhibition of angiogenesis in a spontaneous mammary carcinoma and in a syngenic heterotopic allograft tumor model: a comparative study." pdf
... this article as: Riesterer et al.: Ionizing radiation and inhibition of angiogenesis in a spontaneous mammary carcinoma and in a syngenic heterotopic allograft tumor model: a comparative study Radiation ... conceived of the study, participated in its design and coordination and finalized the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... delay of syngenic mammary carcinoma allografts (A) and orthotopic spontaneous mammary carcinomas (B) in response to IR (4 × Gy) and PTK787 (4 × 100 mg/kg) alone and in combination For the allograft...
- 6
- 269
- 0
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx
... Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cells Suha Saleh1,2, Fiona Wightman1,2, Saumya Ramanayake1, Marina Alexander3, Nitasha Kumar1,2, ... Repository) and supernatants collected at day 1, and poststimulation In both latently infected CCL19-treated cells and in the ACH2 cell line, a combination of the mitogens PHA and PMA was used to achieve ... different models of latency in primary Tcells Others have demonstrated the synergism obtained by treatment with a combination of prostratin and the HDACi vorinostat in both a cell line and primary...
- 31
- 268
- 0
A green supply chain network design model for enhancing competitiveness and sustainability of companies in high north arctic regions
... domestic and international suppliers, and it mainly serves local customers In order to design and maintain an efficient and sustainable supply chain with relatively low risks, the supply chain manager ... deviation between actual value and minimum achievable value The numerator and denominator in this equation share the same unit, and the unit can then be eliminated, and this method also applies ... determine, in an optimal manner, the number and locations of potential facilities, selection of suppliers, and the inter-facility material flow in each stage of a supply chain The indices, input parameters...
- 16
- 340
- 0
Textile and Apparel Barriers and Rules of Origin in a Post-ATC World
... land is fixed in all periods, but the rental price can change according to changes in demand 3.2.3 Balance of payments and trade Changes in the balance of payments are also driven by trends in ... Textile and Apparel Barriers and Rules of Origin in a Post-ATC World Alan Fox U.S International Trade Commission, Washington, DC William Powers U.S International Trade Commission, Washington, DC Ashley ... the combined effect of tariffs and quantitative restraints Conclusion This paper has analyzed the effect of textile and apparel import barriers and regulations on U.S welfare and sectoral activity...
- 33
- 498
- 1
Tài liệu Use Wildcards and Ranges of Values in a SQL Query pdf
... just want to see one per occurrence Comments By placing your use of wild cards and allowing for ranges of values, you can make your applications and the querying of data more versatile than ever! ... statement, this routine assigns it to the Text property of lblSQLString Then the string is used in a data adapter that was created to fill the dtResults data table Last, the data table is set as ... build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults)...
- 5
- 472
- 0
Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt
... for finances and declarations of war; and the popular assemblies were understood to have held the power of electing magistrates and approving the nation’s laws and wars.74 Latter-day republicans ... with growing influence in Asia and Africa, but the theoretical coherence and republican nature of most such political and legal advances go unremarked and unexamined Many people not know what republicanism ... minister in a toga, standing beside a statue of Roman liberty (with her pilleus and vindicta), and worshiping at the sacred flame on her altar Charles Rollin’s Histoire ancienne (1730–1738) and...
- 211
- 750
- 1
a study on awareness and implementation of csr in a multinational companies operating in vietnam
... Organizations ASEAN Association of Southeast Asian Nations IMF International Monetary Fund APEC Asia - Pacific Economic Cooperation ASEM Asia - Europe Meeting VCCI Chamber of Commerce and Industry ... CSR in multinational companies operating in Vietnam With the growing of Vietnam economy, it has attracted many multinational companies to operate in Vietnam such as Dutch Lady, Honda, Vedan Although ... following law and regulations of the organizations Everywhere and every country have its own law and regulation so that each organization operating in one place has to follow the law and regulation...
- 91
- 795
- 1
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... designated HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... used for amplifying the hTRa1 cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ In order to overexpress 4-1BB and TRAF1 in the HeLaTR cells, ... 5¢-CCCGGGATATCATGGCCTCCAGCTCAGGCAG CAGTC-3¢ and 5¢-CCCGGGATATCTAAGTGCTGG TCTCCACAATGCACT-3¢ for TRAF1 precipitated by isopropyl alcohol Single-stranded cDNA was synthesized with lg of the total RNA and...
- 10
- 491
- 0
Báo cáo y học: " Decorin and TGF-β1 polymorphisms and development of COPD in a general population" ppt
... K, Hiramatsu A, Fukushima D, Pierschbacher MD, Okada Y: Degradation of decorin by matrix metalloproteinases: identification of the cleavage sites, kinetic analyses and transforming growth factor-beta1 ... genetically influenced Since the coding SNPs in decorin described in the NCBI and Celera databases were not prevalent in Caucasians (but only in African populations), we genotyped four tagging SNPs, ... development of COPD Competing interest statement The author(s) declare that they have no competing interests Additional File Annual decline in FEV1 according to genotypes of TGF-β1 and decorin Changes in...
- 8
- 384
- 0
Báo cáo y học: "The effect of combined treatment with morphine sulphate and low-dose ketamine in a prehospital setting" doc
... (SD), median and quartiles Demographic data were analysed using parametric t-test Pain and nausea scores were analysed using non-parametric test (Mann-Witney) and sedation, nausea and vomiting scores ... various injuries and those requiring manoeuvring and splinting is ketamine Ketamine offers a safe and effective analgesia since this agent avoids the potential decrease in blood pressure and respiratory ... Demographic data show an equal distribution of men and women in both groups and descriptive data showing comparable readings on most variables The average dose of morphine sulphate in both the M- and...
- 5
- 303
- 0
Molecular transport and structure of DNA in a congested state
... scattering measurements and Monte Carlo simulations Xiaoying Zhu, Siow Yee Ng, Amar Nath Gupta, Yuan Ping Feng, Bow Ho, Alain Lapp, Stefan U Egelhaaf, V Trevor Forsyth, Michael Haertlein, Martine ... determination Gaussian-type distributions of DNA bands are observed in circular DNA closed by ligase or by DNA-relaxing enzyme in the absence of EtdBr and are the result of thermal fluctuation in ... turns in native virion SV40 DNA and minicol DNA determined by the band counting method Cell 8: 215-226 13 Yamada, H., Yoshida, T., Tanaka, K., Sasakawa, C., Mizuno, T 1991 Molecular analysis of...
- 126
- 318
- 0
Sorption, transformation and transport of sulfadiazine in a loess and a sandy soil
... used in animal husbandry as well as in human medicine [Hruska and Franek, 2012, Sarmah et al., 2006] Surface interactions (e.g sorption) as well as transformation processes are controlling factors ... was injected into the Radio-HPLC The peak separation was conducted with a gradient with an increasing amount of methanol, initially with 100% water for The methanol fraction was increased linearly ... transformation processes in soils and evaluating with a compartment model description for the dissipation and transformation of the parent compound and the metabolites in the liquid phase In Chapter the model...
- 135
- 570
- 0
Báo cáo y học: "Intensive intervention for children and adolescents with autism in a community setting in Italy: a single-group longitudinal study" ppsx
... rules of good clinical practice and ethics within the context of a public mental health service, and officially approved and authorised by the Local Health Agency authority Setting and intervention ... goals for each individual is guided by data from that initial assessment, and a curriculum inventory and sequence that lists skills in all domains (learning to learn, communication, social, academic, ... sequential graphic agendas of work are used Data are graphed to provide visual pictures of what is happening with each skill and each maladaptive behaviour targeted for treatment The data are reviewed...
- 9
- 323
- 0
Characterization of CMX 13 and evaluation of efficacy and mechanisms of action in animal model of autoimmunity
... induction of spontaneous apoptosis in cells in the G0/G1 phase This effect of CMX-13 on apoptosis in Jurkat cells was confirmed by DNA fragmentation analysis and Annexin-V staining Apoptosis was induced ... transplant model This is a model of aggressive and rapid allograft rejection with all grafts completely destroyed by day posttransplant In this model, acute rejection (AR) was graded using a pathologic ... Professor Yap Hui Kim and Associate Professor Ang Siau Gek, from the Department Paediatrics and the Faculty of Chemistry, respectively, National University of Singapore for their invaluable advice...
- 331
- 285
- 0
Process evaluation and treatability study of wastewater in a textile dyeing industry
... Tolerance limits for industrial effluents discharged into inland surface water, Indian Standards on Water Pollution, BIS, New Delhi, India Debabrata Mazumder was graduated in the year 1993 with Bachelor ... Immediately after hot washing subsequent to dye fixing softening/hardening is performed as a part of finishing Starch/Polyvinyl acetate and different types of softeners are used at the rate of – ... with varying concentration of alum in the range of 2% - 10% using a Jar test apparatus Firstly, 500 ml each of wastewater sample was taken to six numbers of beakers and added with stock alum solution...
- 14
- 534
- 0
Conservation and Restoration of Glass docx
... Conservation of Library and Archive Materials and the Graphic Arts (Petherbridge) Conservation of Manuscripts and Painting of South-east Asia (Agrawal) Conservation of Marine Archaeological Objects (Pearson) ... over a wide area of the Middle and Near East: Persia (Iran), Elam and Babylonia in the east to Syria and Palestine on the Mediterranean coast; and at other centres of Late Bronze Age civilization ... Islamic glass was already appreciated in medieval Europe In circa 1025 AD a ship of unknown origin and destination, carrying a cargo of approximately tonne of raw and scrap glass, foundered at Serçe...
- 393
- 457
- 0
Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc
... Journal of Artificial Intelligence Research, 3:1—24 Erwin Marsi Antal van den Bosch and Abdelhadi Soudi 2007 Memory-based morphological analysis and partof-speech tagging of arabic In Abdelhadi ... errors: Approximate bayesian inference for linguistic annotation pipelines In EMNLP Nizar Habash and Owen Rambow 2005 Arabic tokenization, part -of- speech tagging and morphological disambiguation in ... also fires, regardless of the part -of- speech, acting as a back-off model of how words in general behave during stemming Linear weights are assigned to each of the transducer’s features using an...
- 9
- 430
- 0
KDIGO Clinical Practice Guideline for the Diagnosis, Evaluation, Prevention, and Treatment of Chronic Kidney Disease-Mineral and Bone Disorder (CKD-MBD) pdf
... requires an understanding of assay type and precision, interassay variability, blood sample handling, and normal postprandial, diurnal, and seasonal variations Owing to these assay and biological variation ... leading cause of death in patients at all stages of CKD) All three of these processes (abnormal mineral metabolism, abnormal bone, and extraskeletal calcification) are closely interrelated and ... calcitriol and vitamin D analogs, and there are no data indicating that the measurement is helpful in guiding therapy or predicting outcomes Alkaline phosphatases Alkaline phosphatases are enzymes that...
- 140
- 777
- 1
Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc
... TTGGCCATATGCAGAAGATCACCGAAGCA ATTCCGGAC ACGGATCCA ATTAATCTC …20 EAMKLVAAAK-31 TCCGGCATATGGAAGCAATGAAGCTCGTC …60 TE-62 TCGCGCATATGACTGAGGATGTTGATGTT (Fig 2A) Each of the c constructs reacted with ... fragment, and Pfu and Taq DNA polymerase were purchased from Takara (Dalian, China) and Promega (Shanghai, China) Sephadex G-50 was purchased from Pharmacia (Uppsala, Sweden) DEAE-cellulose was ... following primers: 5¢-GACGGATCC CCATGACCTTAAATCTTTGT-3¢ as the 5¢ primer and 5¢-ATAGTCGACCTGGTTACGAAGAAATCG-3¢ as the 3¢ primer The PCR products were cleaved with BamHI and EcoRI, and cloned into...
- 7
- 290
- 0
Báo cáo khoa học: Thermal unfolding and aggregation of actin Stabilization and destabilization of actin filaments doc
... G-actin and F-actin that are expressed by an increase or decrease in actin thermal stability We also summarize the in vitro data on the heat-induced aggregation of actin, a process that normally accompanies ... structure of subdomain and its interaction with the adjacent longitudinal protomer in ADP–F-actin [59,60], and probably favors a closed state for the cleft Stabilization and destabilization of F-actin ... proposed that this small protein, a member of a family of actin-sequestering proteins, binds to subdomains and on actin, as well as to the D-loop in subdomain 2, and this binding causes changes in the...
- 16
- 488
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu