... Richard A Brualdi and Bryan L Shader, Matrices of Sign-Solvable Linear Systems, Cambridge Tracts in Mathematics 116, Cambridge University Press, Cambridge (1995) [5] Robert Grossman and Richard ... rows of A if necessary This assumption implies that ajj = for ≤ j ≤ n, and allows us to say that (vj , j, vk ) ∈ Gr if and only if ajk = for all j, k ≤ n Let B be the matrix which consists of ... generalize these results to rectangular zero and sign pattern matrices which guarantee full rank Corollary 2.13 describes amethodfor identifying a spanning set in a finite-dimensional vector space...
... elastic As plate theory is assumed, the transverse strain is absent This is a valid approximation as the disk used is of small thickness It is thin such that plane stress conditions can be assumed ... Shape functions for evaluation of shear in r − z plane Nγη z Shape functions for evaluation of shear in η − z plane W Radial, tangential and shear stresses Shape functions for displacements and ... in-plane response affects transverse response via membrane stresses However, transverse response has no effect at all on in-plane stresses The inplane stresses induced due to large transverse deflection...
... mouse phenotype descriptions This ontology allows comparisons of data from diverse sources, can facilitate MP comparisons across mammalian species, assists in identifying appropriate experimental ... OMIM, and from these records, citations were then chosen These diseases include Type diabetes, Grave s disease, Crohn s disease, autoimmune thyroid disease, multiple sclerosis and inflammatory arthritis ... biomedical vocabularies and standards It has three tools: Metathesaurus, seUMLS mantic network and SPECIALIST Lexicon and Lexical Tools Building Annotated Corpora Phenotype Knowledge Resources Human Phenotype...
... Besylate, Atorvastatin calcium authentic standards and Caduet tablets were subjected to various stress condition In acidic conditions, both Pharm Anal Acta ISSN: 2153-2435 PAA, an open access ... Besylate and Atorvastatin Calcium in Pharmaceutical Dosage Forms, J Chromatogr Separat Techniq 4: 187-192 22 Waghmare AN, Muddukrishna BS, Vasantharaju SG (2014) Analytical Method Development and ... in standard solution peak area response over days was (0.57 and 0.58%) for Amlodipine Besylate, Atorvastatin Calcium respectively Their solutions were found to be stable for days at 5°C at least...
... six states (Madhya Pradesh, Karnataka, Andhra Pradesh, Uttar Pradesh, Maharashtra and Rajasthan) Source: Excerpted from http://itcportal.com/ Smaller and micro scale ICT businesses, such as telecenters, ... programmers, artists, and small businesses in the applications and content fields Collective contributions to international and national competitions and awards, film festivals, foundations, and similar ... institutional, and capacity issues required for successful management of these Funds There are also possibilities for scaling up these funds through innovative financial mechanisms and schemes Periodic assessment...
... separate satellite GLONASS in the bands L2 and L1, is equal to f2/f1=7/9 The GLONASS satellites are transmitting the navigational signals of the standard and heighten accuracy The signals of the standard ... Center for Guidance and Data Analysis provides analysis of all information for supporting high accuracy in the retrieved parameters of a sounded medium and forms the data bank having several levels ... Sensing of the Atmosphere and Ionosphere A detailed description of the stages of elaboration and designing of navigational systems, basic principles, and structure of emitted signals and usage for...
... expressing vector as described in materials and methods 24 hours after transfections cells were harvested and assayed by flow cytometry Ad-GFP transfected cells were analyzed 72 hours after transduction ... Gratwohl A, Hermans J, Apperley J, Arcese W, Bacigalupo A, Bandini G, di Bartolomeo P, Boogaerts M, Bosi A, Carreras E et al.: Acute graft-versus-host disease: grade and outcome in patients with ... 24 hours cells were harvested and analyzed by flow cytometric analysis GFP positivity was assayed in gated as well as in ungated cell populations Control cells were pulsed without DNA and showed...
... loose fill materials are: sand, pea gravel, crushed stone, or slag that meet ASTM C 33 requirements; pumice, scoria, expanded shale, expanded clay, expanded slate, expanded slag, expanded fly ash, ... construction B Restrained Concrete framing Beams fastened securely to the framing numbers Cast-in-place floor or roof systems (such as beam/slab systems, flat slabs, pan joists and waffle slabs) where ... Requirements for Masonry Structures (document also available as ASCE 5-95/TMS 402-95) American Society for Testing and Materials ASTM A 722-90 Specification for Uncoated HighStrength Steel Bar for Prestressing...
... Another possible reason why the Zohdy method works well for this data set is that the subsurface resistivity varies in a gradational manner possibly the result of leachate and groundwater seepage into ... For the initial model, the resistivities of the layers were set to be the same as the measured apparent resistivity values (Fig 2A) Whereas the actual model has a sharp boundary at a depth of 9.1 ... resistivity sections obtained with the standard and modified Zohdy-Barker methods after iterations The model resistivity distribution shows a progressive sharpening of the sides and top of the anomaly...
... dynamics Nevertheless, as the method retains its physical basis through the Navier-Stokes equations, the simulations that it produces often appear realistic and convincingly plausible The typical ... however, steady-state outcome is less critical and dissipation errors are arguably more tolerable For instance, in simulations where near-body characteristics are of primary interest, the presence ... approximated interactions between game characters and fluids is needed 1.3 Results summary Our work adapts the Semi-Lagrangian Stable Fluids simulation method of (Stam, 1999) to the biomechanical visualization...
... same name and other topics describe the same content COCs are lists of statements of the ethical and legal standards which are applied as the basis for decisions and actions [8] and are dedicated ... the importance of ideas and ideals; tolerance, honesty, respect, and ethical behavior; and understanding the needs of those the university serves These values and standards are the basis for the ... policies on how to ensure and maintain the standards [10] A COC of a university is a shared statement of commitment to upholding the ethical, professional and legal standards that is used as the basis...
... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... gels (A, C) and 1% agarose gels (B,D), and proteins were visualized by Coomassie stain Lanes HS and LS are molecular mass standards, with the molecular mass in kDa given on the left (E) 1% agarose ... 5000 single laser shots for MS and MS ⁄ MS analyses, respectively Preparation of aggregate-free monomer for fibrillation assays For fibrillation assays, it is essential to start with a uniform monomeric...
... Journal of Inequalities and Applications infinite dimensional in nature and time-delay is, in many cases, a source of instability The stability issue and the performance of time delayed systems are, ... systems and its applications to modeling and control,” IEEE Transactions on Systems, Man and Cybernetics, vol 15, no 1, pp 116–132, 1985 22 K Tanaka and M Sugeno, “Stability analysis and design ... exponential synchronization scheme, which consists of time delayed fuzzy drive and response systems, is proposed for time delayed chaotic systems with unknown parameters Based on Lyapunov-Krasovskii stability...
... primary modality for disease transmission among injection drug users (IDUs) [1,2] Many states and localities have implemented syringe access programs (SAPs) to reduce the sharing of syringes, ... and adequately address the concerns of law enforcement in planning and implementing SAPs, and rarely emphasize the positive health benefits such programs may have for officers Collaboration and ... programs, and regular meetings are held between police and harm reduction actors [44] Harm reduction training for police has also been conducted in other parts of East and Southeast Asia as well as...
... between mean sound pressures levels and the rank numbers of screening test in studied workplaces The statistic analysis showed that a Pearson 's regression between two assessment scales was 0.771 and ... shift Less than a half shift More than 10 sources 5-9 sources Less than sources More than hours 4-7 hours Less than hours Isn't heard at all It should be shouted It is heard easily 15 Less than 100 ... 56.7% false positives and 0% false negatives in the K2 Asbestos Screening Test (10) Also, Yeagar DE et al reported a sensitivity of 52.63% anda specificity of 94.90% for Posttraumatic stress disorder...
... provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation tunnel ... continues until the air reaches its saturated state, when the air and water temperature reach the same value, called “adiabatic saturation temperature”, being the process known as “adiabatic saturation” ... the advantages and disadvantages and indicating and establishing some basis about their design, was developed by Dr John R Watt, who worked for the Research Laboratory of the U .S Navy He built and...
... to simulate area load uncertainty A normal distribution has two parameters: mean value and standard deviation The mean values are the cluster means obtained by the K-mean algorithm and the standard ... the same standard deviation is assumed for all area loads In this case, Equation (6) is simply written as c = u2p (7) After the covariance matrix C between area loads for each cluster is obtained, ... Table UXE Sensitivity Indices of System and Area to Area Generation and Tie Line Capacities i Case (in Whhear/llW) n I l I Area I Area I Area I Area I System Table I l 1 I I I Area I Area Area...
... controllers For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating enclosures of all reachable states These results have ... they are fairly efficient for exactly known initial states and parameters, they are sometimes insufficient for practical scenarios with uncertain but bounded initial states and parameters which have ... IA-IVP1 is proposed First, an approximate solution of an IVP similar to the considered one is calculated with exactly known initial states and parameters Based on this approximate solution, an easy-to-implement...
... personnel FASAB Federal Accounting Standards Advisory Board FASB Financial Accounting Standards Board FERS Federal Employee Retirement System FG federal government FSB force shaping board FY fiscal ... Government Accountability Office, Military Personnel: DoD Needs to Improve the Transparency and Reassess the Reasonableness, Appropriateness, A ordability, and Sustainability of Its Military Compensation ... called regular military compensation (RMC) RMC includes average basic pay for each military grade, basic allowance for housing, basic allowance for subsistence, and federal tax advantage accruing...