real time reverse transcription polymerase chain reactions

... by real- time RT-PCR of mRNA markers It shows the positive rate of mRNA markers from literature for detection of tumor cells by real- time RT-PCR Abbreviations RT-PCR: Reverse Transcriptase -Polymerase ... Quantitative detection of disseminated free cancer cells in peritoneal washes with real- time reverse transcriptasepolymerase chain reaction: a sensitive predictor of outcome for patients with gastric ... Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real- time reverse transcriptase -polymerase chain reaction to predict recurrence of gastric adenocarcinoma Journal of...

Ngày tải lên: 18/06/2014, 16:20

... Table Sequences of the gene-specific oligonucleotide primers and probes for real- time reverse transcriptase polymerase chain reaction Primer and probe HAS-1 Sequence Position 855F GACTCCTGGGTCAGCTTCCTAAG ... synovium and expression levels of the messages were relatively quantified by real- time reverse transcriptase polymerase chain reaction The expression levels of the messages in OA and RA are expressed ... 38 Cook R, Cook S, Li F, Montelaro R, Issel C: Development of a multiplex real- time reverse transcriptase -polymerase chain reaction for equine infectious anemia virus J Virol Methods 2002, 105:171...

Ngày tải lên: 09/08/2014, 01:24

... of the duplex real- time RT-PCR assay The sensitivity of the duplex real- time RT-PCR was conducted as follows: the reaction consisted of 10 μL × reaction buffer, 0.2 μL reverse transcription enzyme, ... 41:379-385 12 Hull R, Nattanmai S, Kramer LD, Bernard KA, Tavakoli NP: A duplex realtime reverse transcriptase polymerase chain reaction assay for the detection of St Louis encephalitis and eastern ... 41:379-85 doi:10.1186/1743-422X-7-284 Cite this article as: Kang et al.: A duplex real- time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis...

Ngày tải lên: 12/08/2014, 01:22

... used realtime polymerase chain reaction-based method Hepatology 2007, 46:22-31 Chevaliez S, Bouvier-Alias M, Castéra L, Pawlotsky JM: The Cobas AmpliPrep-Cobas TaqMan real- time polymerase chain ... TaqMan assay real time PCR approach Clin Chem Lab Med 2008, 46:1729-1731 Huang J, Yang CM, Wang LN, Meng S, Deng W, Li JM: A novel real- time multiplex reverse transcriptase -polymerase chain reaction ... pyrocarbonate-treated H2O and used as the template for the duplex real- time RT-PCR assay Duplex real- time RT-PCR amplification for HCV RNA detection The duplex real- time RT-PCR assay was performed on the ABI PRISM...

Ngày tải lên: 12/08/2014, 04:20

... hợp, sau đó tiế n hành tổ ng hơ ̣p RNA với bô ̣ sinh phẩ m TranscriptA id™ T7 High Yield Transcription Kit (Fermentas) Nồ ng đô ̣ RNA đươ ̣c xác đinh bằ ng cách đo khả hấ p phu ̣...

Ngày tải lên: 10/02/2014, 20:39

... isolation and real- time RT-PCR -/-: Negative results in both virus isolation and real- time RT-PCR 350 Dong Kun Yang et al has several advantages over conventional PCR First, realtime RT-PCR yields ... Reproducibility of realtime RT-PCR was tested three times at different day (B) reaction mixture, resulted in Ct values ranging from 24.7 to 46.1 cycles Application of the real- time RT- PCR assay ... before 70 days of gestation also were tested by realtime RT-PCR, but did not show any positive reactions for JE viral RNA (Fig 5B) Fig Application of real- time RT-PCR assay to plasma samples collected...

Ngày tải lên: 07/08/2014, 18:20

Ngày tải lên: 07/08/2014, 18:21

... quantitate these mRNAs, e.g northern blotting or real- time PCR, would reveal a correlation either Conclusions QC-RT-PCR and related techniques such as real- time PCR are not useful as substitutes for ... blood, such as that from a heelstick or finger-prick [2] Quantitative methods for reverse transcriptase polymerase chain reaction (RT-PCR) are rapidly surpassing all other methods of quantifying ... and Maloney murine leukemia virus reverse transcriptase (Promega, Madison, WI), diluted to 3, then µl is used as template in a 25 µl PCR The remainder of the reactions were made up by µl PCR Buffer...

Ngày tải lên: 11/08/2014, 08:20

... 13:R148 Ellis J, Iturriza M, Allen R, Bermingham A, Brown K, Gray J, Brown D: Evaluation of four real- time PCR assays for detection of influenza A(H1N1)v viruses Euro Surveill 2009, 14:pii 19230...

Ngày tải lên: 13/08/2014, 19:20

... 1.3.3 Phương pháp sinh học phân tử 20 1.3.3.1.Phương pháp RT – PCR (Reverse – transcription polymerase chain reaction) 20 1.3.3.3 Các thành phần phản ứng PCR 23 CHƢƠNG 2: VẬT ... triphosphate dCTP: Deoxycytidine triphosphate UTRs: Untranslated regions RT-PCR: Reverse transcription polymerase chain reaction kDa: kilo dalton H&E: Hematoxylin EoSin LỜI MỞ ĐẦU Ngày việc khai ... virus(YHV), Taura syndrome virus(TSV) Gill-associated virus(GAV) tôm kỹ thuật Multiplex Reverse transcription polymerase chain reaction” thực nhằm mục đích 11 CHƢƠNG 1: TỔNG QUAN TÀI LIỆU 1.1 Tình hình...

Ngày tải lên: 31/08/2014, 07:43

... Neuraminidase NP: Nucleoprotein NS: Non-structural protein PA: Polymerase A protein PB: Polymerase B protein RT-PCR: Reverse Transcription - Polymerase Chain Reaction RNA: Ribonucleic acid TBE: Tris Base, ... thuật RT-PCR (Reverse Transcription - Polymerase Chain Reaction) Đây kỹ thuật sinh học phân tử, cho phép phát virus với độ xác cao, thời gian làm xét nghiệm khoảng 4-6 thực Realtime RT-PCR 12-24 ... HIỆN NHANH VIRUS CÚM GIA CẦM A/H5N1 TRONG MẪU BỆNH PHẨM BẰNG KỸ THUẬT MULTIPLEX REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION Chuyên ngành: Sinh học thực nghiệm Mã số: 60 42 30 LUẬN VĂN THẠC...

Ngày tải lên: 31/03/2015, 16:19

... mẫu Polymerase Chain Reaction Phản ứng chuỗi trùng hợp Reverse Transcription Polymerase Chain Reaction Phản ứng chuỗi đồng phân hóa chép ngƣợc mRTPCR Multiplex Reverse Transcription Polymerase Chain ... HỘI CHỨNG RỐI LOẠN SINH SẢN VÀ HÔ HẤP Ở LỢN BẰNG PHƢƠNG PHÁP MULTIPLEX RT-PCR (REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION) Chuyên ngành : Động Vật Học Mã số : 60 42 01 03 LUẬN VĂN THẠC SĨ ... virus gây hội chứng rối loạn sinh sản hô hấp lợn phƣơng pháp multiplex RT-PCR (Reverse Transcription Polymerase Chain Reaction)” Mục tiêu: Giải trình tự toàn vùng gen ORF7 virus PRRS phân lập...

Ngày tải lên: 30/11/2015, 20:08

... quy trình phát nhanh virus cúm gia cầm A/H5N1 mẫu bệnh phẩm kỹ thuật Multiplex Reverse Transcription Polymerase Chain Reaction” Labo Trường Đại học Y Thái Bình với mục tiêu: Thiết kế lựa chọn ... virus cúm A/H5N1 bao gồm: phân lập virus; phát kháng nguyên; phát RNA virus kỹ thuật RT-PCR, realtime RT-PCR phát tăng hiệu giá kháng thể huyết bệnh nhân Trong giai đoạn dịch cúm A/H5N1 bùng ... đại đoạn khuôn mẫu RNA theo nguyên lý PCR, bao gồm giai đoạn: Giai đoạn 1: Phiên mã ngược (RT -Reverse transcription) khuôn mẫu RNA thành sợi DNA thứ nhất, sau dùng sợi làm khuôn để tổng hợp sợi...

Ngày tải lên: 17/06/2016, 22:59

... purposes) Journal of Nanobiotechnology 2003, Methods Quantitative Reverse Transcriptase -Polymerase Chain Reaction (RT-PCR) Real- time quantitative RT-PCR analysis of gene expression [13,14] was ... seconds Real- time quantitative RT-PCR was assayed on an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA) and the accumulation of PCR product was measured in real time ... hepatitis C virus genome in formalin-fixed paraffin-embedded liver tissue by in situ reverse transcription polymerase chain reaction J Med Virol 1994, 44:406-409 Martinez A, Miller MJ, Quinn K, Unsworth...

Ngày tải lên: 11/08/2014, 00:21

... Briefly, RNA was extracted from 280 μl of serum using the QIAamp Viral RNA minikit Reverse transcription and polymerase chain reaction was performed using the One-Step Superscript III/RT/Platinum Taq ... does not provide information on the serotype of the virus However, single-step reverse transcriptase polymerase chain reaction (RT-PCR) detection and typing of dengue virus offers a sensitive, ... identified as being dengue positive and selected for confirmation and serotyping by reverse transcriptase polymerase chain reaction In 2003, 45 specimens were analysed of which 14 were males and 31...

Ngày tải lên: 12/08/2014, 04:21

... transplantation by real- time PCR of Page of which two were positive by pp65 antigenemia assay and 12 were negative by both real- time PCR and pp65 antigenemia assay One donor was positive only by realtime PCR ... assays 10 Real Time PCR Assay Real- time PCR targeting the morphologically transforming region mtr II sequence was applied onto the DNA extracted from these specimens in Rotor gene Real time PCR ... patients samples positive for pp65 antigenemia were also positive for real time PCR also - Eleven more were positive only by real time PCR assay Madhavan et al Virology Journal 2010, 7:322 http://www.virologyj.com/content/7/1/322...

Ngày tải lên: 12/08/2014, 02:20

... wild-type strain were confirmed by Rapid test which BioNote, Inc produced Multiplex reverse transcription- nested polymerase chain reaction Phylogenetic analysis and detection of CDV in field samples by ... Amplification of genomes of different easily infected canine viruses by multiplex reverse transcription- nested polymerase chain reaction Lane 1: positive control of canine distemper virus (CDV) vaccine ... 2005, 29:347-59 10 Li JZ, He HB, Xia XZ, et al.: Establishment and application of reverse transcription Polymerase chain reaction for diagnosis of canine distemper virus Chinese journal of virology...

Ngày tải lên: 12/08/2014, 04:20

... Knowles NJ, Hutchings GH, Cooper EJ, Smith AW, Ferris NP: Development of a real- time reverse transcription polymerase chain reaction assay for detection of marine caliciviruses (genus Vesivirus) ... Figure Establishment of the fluorescent quantitative real- time PCR (FQ-PCR) standard curve Establishment of the fluorescent quantitative real- time PCR (FQ-PCR) standard curve Ten-fold dilutions ... applicability of real- time PCR for the quantification of GPV because of its remarkable sensitivity and high-throughput potential, which is beyond the scope of other diagnostic methods The real- time PCR...

Ngày tải lên: 12/08/2014, 04:20

... novel real- time reverse- transcriptase polymerase chain reaction J Infect Dis 2004, 189:652-657 15 van Doornum GJ, Guldemeester J, Osterhaus AD, Niesters HG: Diagnosing herpesvirus infections by real- time ... needed to determine the real clinical impact of multiple infections and to determine whether the use of real- time PCR prevents unnecessary antibiotic treatment However, real- time PCR offers a rapid, ... diagnosed by viral culture Real- time PCR detected a total of 33 respiratory viruses in 22 (96%) patients All positive results found by conventional techniques were confirmed by real- time PCR RSV was the...

Ngày tải lên: 12/08/2014, 23:23