procedures of mechanical therapy for the thoracic spine
báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps
... insertion of spinal markers for radiotherapy However, there are data suggesting that there may be increased accuracy of fiducial markers with the use of other forms of IGRT Watchman et al [10] compared ... evaluated by an orthopedic surgeon (JH) for implantation of fiducial markers for IGRT because of the proximity of the tumor to the spinal cord Markers were placed in the operating room with fluoroscopic ... at the surgical sites, which lasted for three days and was controlled with over -the- counter pain medications The patient underwent CT simulation for radiation therapy planning with the use of...
- 5
- 279
- 0
báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf
... overall survival of treated animals (Figure 6D) These results confirm the anti-tumor activity of anti-VLC therapy, as observed by others, and further support the use of anti-CD52 therapy in humans ... therapy twice-weekly for three weeks Therapy was then discontinued and tumor growth was monitored for several weeks Therapy significantly restricted solid tumor growth throughout the course of ... collected at the University of Pennsylvania or the University of Michigan After obtaining informed patient consent, ascites was collected either intraoperatively or at the time of therapeutic...
- 14
- 728
- 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... Determination of the level of RNA products of the H19 gene The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse primers using 0.05 units/μl of ... Discussion The present work shows the use of the regulatory sequences of the H19 gene for the development of DNAbased therapy for human ovarian cancer related ascites The successful development of anti-tumor ... control to test the specificity of the ISH The intensity of the hybridization signal was indicated as (+1) for weak, (+2) for moderate and (+3) for strong signals The distribution of the hybridization...
- 11
- 559
- 0
Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt
... a blue star, the vaccine therapy trials with a red circle, and the combined cellular and vaccine therapy trials with a white triangle Cellular Therapy Trials The adoptive transfer of ex vivo activated ... that the overall number of open trials is encouragingly higher However, while the number of cellular therapy trials remained the same, the clear trend was towards an increase in the number of vaccine ... and quality of life to become integrated into the standard of care regime [5,52-54] The number of slots open for patient accrual to the immunotherapy protocols contained in our list of open trials...
- 10
- 589
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... cycles of 94°C for 30 sec, 59°C for 45 sec and 72°C for 60 sec, and finally 72°C for The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse ... ml HCl 0.1N for 15-sec (The bladder is rather resistant to implantation of cells, and therefore it is necessary to create abrasions in the bladder mucosa of the anesthetized rodent either by acid, ... (5’-TCCTCCTCCTCCTGCCCCAGCG), for the P4 transcript in the forward direction and the reverse primer (5’- CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon and the 5’ end of exon without the introns...
- 18
- 746
- 0
Báo cáo khoa học: "Feasibility study of volumetric modulated arc therapy for the treatment of retroperitoneal sarcomas" pdf
... advantage for small bowel was observed with IMRT in their study where they defined the CTV as a part of the whole GTV Additionally, the presence of the tumor shifted small bowel outside of the PTV ... maximal dose of 124% inside the PTV This hotspot wouldn’t have been observed if we had covered 95% of the volume by 95% of the dose Nevertheless, we may wonder whether the presence of these hotspots ... defined as the ratio between the volume receiving at least 95% of the prescribed dose and the volume of the PTV (CI95%) The homogeneity index (HI) was expressed by D5% D95% (difference between the dose...
- 10
- 438
- 0
Báo cáo y học: " Exercise therapy for the management of osteoarthritis of the hip joint: a systematic review" pot
... performance based), and quality of life Examples of self-reported pain included the VAS; the pain subscale of the Harris Hip Score; and/or the pain subscale of the Health Related Quality of Life ... Health Related Quality of Life Table Level of evidence for evaluating the efficacy of exercise therapy in the management of osteoarthritis of the hip Level of evidence Definition Strong evidence ... groups • Exercise therapy vs manual therapy • Two groups of 109 subjects: Exercise therapy: (53 subjects) 25 2× per week for weeks, total of individual sessions + home program Manual therapy: (56...
- 9
- 512
- 0
Báo cáo y học: " Solid variant of aneurysmal bone cyst of the thoracic spine: a case report" ppsx
... [6], the cervical spine was involved in 22% of cases, the thoracic spine in 34%, the lumbar spine in 31%, and the sacrum in 13% Bertoni et al [3] reviewed 15 cases of the solid variant of aneurysmal ... illustration of the manuscript AA analyzed and interpreted the pathological data for our patient WEW aided in the editing of the manuscript DJC aided in the editing of the manuscript TGL aided in the ... osteolytic lesion occupying the left part of the vertebral body of T6 destroying the lamina and pedicle as well as the associated rib at that level MRI of the thoracic spine (Figure 2) revealed a large...
- 6
- 622
- 0
Báo cáo y học: " Dental problems delaying the initiation of interferon therapy for HCV-infected patients" pptx
... weeks for therapeutic management and education about liver diseases We determined whether dental problems delayed the initiation of IFN therapy for these patients Patients who underwent Peg-IFN therapy ... initiation of Peg-IFN therapy Period to Underlying onset of IFN disease treatment after dental therapy (days) IFN Effect of therapy IFN treatment 50 F CH-C 980 kIU/ml 1b #1 Acute periostitis of the ... IFN therapy for a maximum of 105 days HCV-infected patients treated with IFN therapy should be managed by intensive oral care because of lower resistance to infection during the therapy Poor of...
- 5
- 223
- 0
Báo cáo y học: "Cost of acute renal replacement therapy in the intensive care unit: results from The Beginning and Ending Supportive Therapy for the Kidney (BEST Kidney) Study" pps
... domain The error bars represent the range between the maximum cost of each domain for CRRT and the minimum cost for IRRT and the maximum cost of each domain for IRRT and minimum cost for CRRT The ... multiplying the actual amount of fluid used for the first 24 hours by the cost of each type of fluid, which varied by each center and country Because of the on-line dialysate production for IRRT, ... Supportive Therapy for the Kidney; CRRT: continuous renal replacement therapy; ICU: intensive care unit; IQR: interquartile range; IRRT: intermittent renal replacement therapy; RRT: renal replacement therapy...
- 10
- 453
- 0
Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx
... prevent the development of lung injury when used as the initial mode of ventilation [11-14] Therefore, the clinically relevant questions now become whether inhaled APC can diminish the severity of ... diminishing the enhanced apoptosis of epithelial and other cell populations which accompanies acute lung injury In the present experiments, treatment with APC was started before the initiation of injurious ... in the presence of acute lung injury due to sepsis or other etiologies and whether inhaled APC can prevent or minimize primary or secondary lung damage when low tidal volumes are used for mechanical...
- 2
- 391
- 0
MSC circ 1006 GUIDELINES ON FIRE TEST PROCEDURES FOR ACCEPTANCE OF FIRERETARDANT MATERIALS FOR THE CONSTRUCTION OF LIFEBOATS
... name of testing body; name of manufacturer of the material; date of supply of the materials and of tests; name or identification of the material; description of the material; density of the material; ... not be cut from the edges) should be exposed in the vertical plane perpendicular to the gel-coat surface to the tip of the blue flame of the propane gas torch for an initial period of one minute ... MSC/Circ.1006 ANNEX FIRE TEST PROCEDURES FOR ACCEPTANCE OF FIRE-RETARDANT MATERIALS FOR THE CONSTRUCTION OF LIFEBOATS Application This test procedure should be used for the acceptance of fire-retardant and...
- 6
- 345
- 0
Utilization of activated carbon for the removal of basic dyes in fixed-bed microcolumn
... profile and a more efficient performance were obtained in the case of smaller particle sizes All the curves show the classic “S” shape profile The enhancement of the column performance with the ... achieved in the case of PAC2 than that in the case of F400 Regarding the BY dye, F400 showed better performance than PAC2 for the removal of BY dye This is evident from a comparison of the time ... prediction of column adsorption process requires prediction of breakthrough curves for the effluent The maximum adsorption capacity of an adsorbent is also required in the design of the column The Thomas...
- 10
- 561
- 0
Introduction of Neuroethics Challenges for the 21st Century
... have therefore delivered a powerful blow to the dualist view The sciences of the mind have delivered another, or rather a series of others The cognitive sciences – the umbrella term for the disciplines ... immortality of the soul and therefore of resurrection and of eternal reward and punishment If the soul is immaterial, then there is no reason to believe that it is damaged by the death and decay of the ... descendant of the Cartesian view On this everyday conception, I am the set of thoughts that cross my mind This conception of the self might offer some comfort, in the face of all the evidence about the...
- 68
- 571
- 0
Basics of radio astronomy for the goldstone apple valley radio telescope
... forms is lower than the frequency of the source wave form When the distance is decreasing, the frequency of the received wave form will be higher than the source wave form The Doppler effect is ... _ range of the electromagnetic spectrum In the visible light range, the end of the spectrum has higher frequencies than the end of the spectrum The linear polarization of an electromagnetic ... bent toward the perpendicular as they travel into the glass Likewise, the path will be bent to the same extent away from the perpendicular when they exit the other side of glass Effects of Media...
- 109
- 462
- 0
Tài liệu The Role of Nutrition in Maintaining Health in the Nation’s Elderly: Evaluating Coverage of Nutrition Services for the Medicare Population ppt
... therapy For the purposes of this report, the term nutrition therapy is defined as the treatment of a disease or condition through the modification of nutrient or whole-food intake Nutrition therapy ... with the exception of the role of enteral and parenteral nutrition therapy, a preliminary review of the literature revealed insufficient data at this time regarding the role of nutrition therapy, ... secure the services of eminent members of appropriate professions in the examination of policy matters pertaining to the health of the public The Institute acts under the responsibility given to the...
- 383
- 606
- 2
Tài liệu Báo cáo Y học: Role of sulfoquinovosyl diacylglycerol for the maintenance of photosystem II in Chlamydomonas reinhardtii ppt
... pocket, which is the exit of the electron flow in the PSII complex According to the increase in the sensitivity to diuron in hf-2, the limitation of the electron transfer at the exit of the PSII complex ... conformational change of the PSII complex may cause the decrease of PSII activity in hf-2 by the lack of specific binding of SQDG to the PSII complex Alternatively, the change of the lipophilic surrounding ... condition The supplementation of SQDG in the medium enabled the mutant to grow even in the presence of diuron (Fig 3) The exogenously applied SQDG is incorporated into the mutant cells in the form of...
- 6
- 500
- 0
Critical evaluation of diagnostic aids for the detection of oral cancer docx
... respectively One of the weaknesses of this study is the small sample size In addition, the majority of the lesions examined appear to be of the Class I type, rather than Class II lesions for which the technology ... appropriate to the purpose of the test? Use examiners representative of the target or primary clinical providers of the test? Show evidence that the test can distinguish cancer/precancer from other conditions ... predictive value Therefore, the lack of apparent control as well as documentation with respect to the manner in which the sample was selected limits the utility of this study Poate et al performed a...
- 13
- 1,099
- 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... degrading entities [18] For example, the major role of the MMP family is the control of cellular responses critical to homeostatic regulation of the extracellular environment and the immune response ... level match-sets are the reference gels of the respective quadrants from the 2D gel sections of each condition and the four higher-level match-sets are the reference gels of the two different conditions ... enabled the performance of four independent image analyses in which the gel parts of each corresponding quadrant were used to construct four independent reference gels instead of one The corresponding...
- 20
- 506
- 0
Báo cáo khoa học: Identification of crucial residues for the antibacterial activity of the proline-rich peptide, pyrrhocoricin pot
... verified the binding of pyrrhocoricin to the E coli DnaK fragment and the lack of a sequence analogous to that of S aureus (Fig 6) To study the interaction of the antibacterial peptide and the synthetic ... detected for the binding fragment of the responsive strain E coli, but not for the nonbinding fragment of the unresponsive strain S aureus (Fig 6) If any consequence for the nature of the Ó FEBS ... while the N-terminus served as the pharmacophore and hence the interactive domain with the bacterial target protein, the C-terminal half aided the delivery of the pharmacophore into the interior of...
- 12
- 442
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25