procedures of mechanical therapy for the cervical spine
Báo cáo y học: "Osteoradionecrosis of the cervical spine presenting with quadriplegia in a patient previously treated with radiotherapy for laryngeal cancer: a case report" docx
... after completion of radiotherapy [4] This appears to be the first reported case where radiotherapy to the larynx was the sole cause of osteoradionecrosis of the cervical spine Four other reports ... osteoradionecrosis of the cervical spine vertebrae secondary to the radiotherapy 20 years earlier and not due to metastatic disease as reported by the MRI scan A literature search using the Medline ... and paraesthesia in his right arm A further MRI scan (see Figure 2) revealed a reduction of the disc height at C4-5 and C5-6, a loss of height of the C5 vertebral body and retrolisthesis of C5 on...
- 4
- 208
- 0
báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf
... overall survival of treated animals (Figure 6D) These results confirm the anti-tumor activity of anti-VLC therapy, as observed by others, and further support the use of anti-CD52 therapy in humans ... therapy twice-weekly for three weeks Therapy was then discontinued and tumor growth was monitored for several weeks Therapy significantly restricted solid tumor growth throughout the course of ... collected at the University of Pennsylvania or the University of Michigan After obtaining informed patient consent, ascites was collected either intraoperatively or at the time of therapeutic...
- 14
- 728
- 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... Determination of the level of RNA products of the H19 gene The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse primers using 0.05 units/μl of ... Discussion The present work shows the use of the regulatory sequences of the H19 gene for the development of DNAbased therapy for human ovarian cancer related ascites The successful development of anti-tumor ... control to test the specificity of the ISH The intensity of the hybridization signal was indicated as (+1) for weak, (+2) for moderate and (+3) for strong signals The distribution of the hybridization...
- 11
- 559
- 0
Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt
... a blue star, the vaccine therapy trials with a red circle, and the combined cellular and vaccine therapy trials with a white triangle Cellular Therapy Trials The adoptive transfer of ex vivo activated ... that the overall number of open trials is encouragingly higher However, while the number of cellular therapy trials remained the same, the clear trend was towards an increase in the number of vaccine ... and quality of life to become integrated into the standard of care regime [5,52-54] The number of slots open for patient accrual to the immunotherapy protocols contained in our list of open trials...
- 10
- 589
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... cycles of 94°C for 30 sec, 59°C for 45 sec and 72°C for 60 sec, and finally 72°C for The PCR reactions were carried out in 25 μl volumes in the presence of ng/μl of each of the forward and the reverse ... ml HCl 0.1N for 15-sec (The bladder is rather resistant to implantation of cells, and therefore it is necessary to create abrasions in the bladder mucosa of the anesthetized rodent either by acid, ... (5’-TCCTCCTCCTCCTGCCCCAGCG), for the P4 transcript in the forward direction and the reverse primer (5’- CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon and the 5’ end of exon without the introns...
- 18
- 746
- 0
Báo cáo khoa học: "Feasibility study of volumetric modulated arc therapy for the treatment of retroperitoneal sarcomas" pdf
... advantage for small bowel was observed with IMRT in their study where they defined the CTV as a part of the whole GTV Additionally, the presence of the tumor shifted small bowel outside of the PTV ... maximal dose of 124% inside the PTV This hotspot wouldn’t have been observed if we had covered 95% of the volume by 95% of the dose Nevertheless, we may wonder whether the presence of these hotspots ... defined as the ratio between the volume receiving at least 95% of the prescribed dose and the volume of the PTV (CI95%) The homogeneity index (HI) was expressed by D5% D95% (difference between the dose...
- 10
- 438
- 0
Báo cáo y học: " Exercise therapy for the management of osteoarthritis of the hip joint: a systematic review" pot
... performance based), and quality of life Examples of self-reported pain included the VAS; the pain subscale of the Harris Hip Score; and/or the pain subscale of the Health Related Quality of Life ... Health Related Quality of Life Table Level of evidence for evaluating the efficacy of exercise therapy in the management of osteoarthritis of the hip Level of evidence Definition Strong evidence ... groups • Exercise therapy vs manual therapy • Two groups of 109 subjects: Exercise therapy: (53 subjects) 25 2× per week for weeks, total of individual sessions + home program Manual therapy: (56...
- 9
- 512
- 0
báo cáo khoa học: "Partial tetraplegic syndrome as a complication of a mobilizing/manipulating procedure of the cervical spine in a man with Forestier’s disease: a case report" pot
... impossible to meaningfully estimate the size of the risk of post-treatment complications’ [16] Fractures of the cervical spine seem to be a rare subgroup of the irreversible and serious complications ... Baumgartner H, Antinnes JA: Frequency of complications of manipulation of the spine A survey among the members of the Swiss Medical Society of Manual Medicine Eur Spine J 1993, 2:136-139 12 Hannallah ... median-sagittal plane of the cervical spine There is a C 6/7 luxation fracture without evidence for a profound spinal cord lesion The degenerative alterations, particularly the large bridging spondylophytes...
- 4
- 319
- 0
Báo cáo y học: " Primary bony non-Hodgkin lymphoma of the cervical spine: a case report" ppt
... paralysis The treatment of these lesions is often multifactorial, and includes surgery, radiotherapy, and chemotherapy [14] A discussion of the pros and cons of these treatment options is beyond the ... It accounts for only 1% of all cases, Page of and of these, primary vertebral locations account for only 1.7% of primary bone lymphomas [1,2] In our case, the patient presented with cervical spinal ... Compression of the spinal cord in the epidural space is shown with distortion of the cord at this level Page of was noticed that his left side had acutely progressed to only a flicker of movement in the...
- 4
- 268
- 0
Báo cáo y học: " Dental problems delaying the initiation of interferon therapy for HCV-infected patients" pptx
... weeks for therapeutic management and education about liver diseases We determined whether dental problems delayed the initiation of IFN therapy for these patients Patients who underwent Peg-IFN therapy ... initiation of Peg-IFN therapy Period to Underlying onset of IFN disease treatment after dental therapy (days) IFN Effect of therapy IFN treatment 50 F CH-C 980 kIU/ml 1b #1 Acute periostitis of the ... IFN therapy for a maximum of 105 days HCV-infected patients treated with IFN therapy should be managed by intensive oral care because of lower resistance to infection during the therapy Poor of...
- 5
- 223
- 0
Báo cáo y học: "Withdrawal rates as a consequence of disclosure of risk associated with manipulation of the cervical spine" pot
... from the selected therapy Therefore, consent needs to be sought for every condition and therapy and not simply per patient It is also important that the patient understands that in the process they ... [20] The above illustrates how difficult it is to quantify the material risks [21] related to cervical manipulation It highlights the need for further exploration of the causes and incidence of ... by the number of respondents who disclosed data in response to the question (ii) Withdrawal rate for total time in practice: Page of For each respondent who provided the data, the number of patients...
- 7
- 301
- 0
Báo cáo y học: "Cost of acute renal replacement therapy in the intensive care unit: results from The Beginning and Ending Supportive Therapy for the Kidney (BEST Kidney) Study" pps
... domain The error bars represent the range between the maximum cost of each domain for CRRT and the minimum cost for IRRT and the maximum cost of each domain for IRRT and minimum cost for CRRT The ... multiplying the actual amount of fluid used for the first 24 hours by the cost of each type of fluid, which varied by each center and country Because of the on-line dialysate production for IRRT, ... Supportive Therapy for the Kidney; CRRT: continuous renal replacement therapy; ICU: intensive care unit; IQR: interquartile range; IRRT: intermittent renal replacement therapy; RRT: renal replacement therapy...
- 10
- 453
- 0
Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx
... prevent the development of lung injury when used as the initial mode of ventilation [11-14] Therefore, the clinically relevant questions now become whether inhaled APC can diminish the severity of ... diminishing the enhanced apoptosis of epithelial and other cell populations which accompanies acute lung injury In the present experiments, treatment with APC was started before the initiation of injurious ... in the presence of acute lung injury due to sepsis or other etiologies and whether inhaled APC can prevent or minimize primary or secondary lung damage when low tidal volumes are used for mechanical...
- 2
- 391
- 0
MSC circ 1006 GUIDELINES ON FIRE TEST PROCEDURES FOR ACCEPTANCE OF FIRERETARDANT MATERIALS FOR THE CONSTRUCTION OF LIFEBOATS
... name of testing body; name of manufacturer of the material; date of supply of the materials and of tests; name or identification of the material; description of the material; density of the material; ... not be cut from the edges) should be exposed in the vertical plane perpendicular to the gel-coat surface to the tip of the blue flame of the propane gas torch for an initial period of one minute ... MSC/Circ.1006 ANNEX FIRE TEST PROCEDURES FOR ACCEPTANCE OF FIRE-RETARDANT MATERIALS FOR THE CONSTRUCTION OF LIFEBOATS Application This test procedure should be used for the acceptance of fire-retardant and...
- 6
- 345
- 0
Utilization of activated carbon for the removal of basic dyes in fixed-bed microcolumn
... profile and a more efficient performance were obtained in the case of smaller particle sizes All the curves show the classic “S” shape profile The enhancement of the column performance with the ... achieved in the case of PAC2 than that in the case of F400 Regarding the BY dye, F400 showed better performance than PAC2 for the removal of BY dye This is evident from a comparison of the time ... prediction of column adsorption process requires prediction of breakthrough curves for the effluent The maximum adsorption capacity of an adsorbent is also required in the design of the column The Thomas...
- 10
- 561
- 0
Introduction of Neuroethics Challenges for the 21st Century
... have therefore delivered a powerful blow to the dualist view The sciences of the mind have delivered another, or rather a series of others The cognitive sciences – the umbrella term for the disciplines ... immortality of the soul and therefore of resurrection and of eternal reward and punishment If the soul is immaterial, then there is no reason to believe that it is damaged by the death and decay of the ... descendant of the Cartesian view On this everyday conception, I am the set of thoughts that cross my mind This conception of the self might offer some comfort, in the face of all the evidence about the...
- 68
- 571
- 0
Basics of radio astronomy for the goldstone apple valley radio telescope
... forms is lower than the frequency of the source wave form When the distance is decreasing, the frequency of the received wave form will be higher than the source wave form The Doppler effect is ... _ range of the electromagnetic spectrum In the visible light range, the end of the spectrum has higher frequencies than the end of the spectrum The linear polarization of an electromagnetic ... bent toward the perpendicular as they travel into the glass Likewise, the path will be bent to the same extent away from the perpendicular when they exit the other side of glass Effects of Media...
- 109
- 462
- 0
Tài liệu The Role of Nutrition in Maintaining Health in the Nation’s Elderly: Evaluating Coverage of Nutrition Services for the Medicare Population ppt
... therapy For the purposes of this report, the term nutrition therapy is defined as the treatment of a disease or condition through the modification of nutrient or whole-food intake Nutrition therapy ... with the exception of the role of enteral and parenteral nutrition therapy, a preliminary review of the literature revealed insufficient data at this time regarding the role of nutrition therapy, ... secure the services of eminent members of appropriate professions in the examination of policy matters pertaining to the health of the public The Institute acts under the responsibility given to the...
- 383
- 606
- 2
Tài liệu Báo cáo Y học: Role of sulfoquinovosyl diacylglycerol for the maintenance of photosystem II in Chlamydomonas reinhardtii ppt
... pocket, which is the exit of the electron flow in the PSII complex According to the increase in the sensitivity to diuron in hf-2, the limitation of the electron transfer at the exit of the PSII complex ... conformational change of the PSII complex may cause the decrease of PSII activity in hf-2 by the lack of specific binding of SQDG to the PSII complex Alternatively, the change of the lipophilic surrounding ... condition The supplementation of SQDG in the medium enabled the mutant to grow even in the presence of diuron (Fig 3) The exogenously applied SQDG is incorporated into the mutant cells in the form of...
- 6
- 500
- 0
Critical evaluation of diagnostic aids for the detection of oral cancer docx
... respectively One of the weaknesses of this study is the small sample size In addition, the majority of the lesions examined appear to be of the Class I type, rather than Class II lesions for which the technology ... appropriate to the purpose of the test? Use examiners representative of the target or primary clinical providers of the test? Show evidence that the test can distinguish cancer/precancer from other conditions ... predictive value Therefore, the lack of apparent control as well as documentation with respect to the manner in which the sample was selected limits the utility of this study Poate et al performed a...
- 13
- 1,099
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008