prevent the system from booting automatically after a reset by setting the auto boot paramet
Báo cáo hóa học: " Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008" pptx
... Cátia Regina Branco da Fonseca,Aff1 Corresponding Affiliation: Aff1 Email: catiafonseca@fmb.unesp.br Maria Wany Louzada Strufaldi,Aff2 Email: mwany@uol.com.br Lídia Raquel de Carvalho,Aff3 Email: ... de A ões Programáticas Estratégicas Área Técnica de Saúde da Mulher: Prenatal care and puerperium: skilled and humanized assistance – Technical Manual Brasília: Ministério da Saúde; 2005 43 Araujo ... cities in the country This regional difference has been currently attributed to the availability of prenatal and perinatal care rather than to social condition The latter was the main cause of...
- 18
- 422
- 0
Báo cáo Y học: The refolding of type II shikimate kinase from Erwinia chrysanthemi after denaturation in urea pot
... (PK) and lactate dehydrogenase (LDH) The production of ADP in the shikimate kinase-catalysed reaction leads to the conversion of NADH to NAD+, which is monitored by the decrease in A3 40 The assay ... on the coupling enzymes [22] The SK-catalysed reaction was carried out in an assay solution containing mM ATP, 1.6 mM shikimate and the appropriate concentration of urea in the assay buffer At ... be about 80 s after the start of refolding, taking into account the time taken for appropriate dilution into the assay solution and for the double coupled assay system to achieve a constant rate...
- 9
- 413
- 0
"The Potential of Cellulosic Ethanol Production from Municipal Solid Waste: A Technical and Economic Evaluation" doc
... CP) at a fixed Spezyme CP loading of 10 mg/g total glucan and xylan in the raw biomass and at a fixed total enzyme protein loading of 10 mg/g total glucan and xylan in the raw biomass BSA Treatment ... (urban wood fuel), final alternative daily cover (ADC Final, landfill mulch), ADC green, woody and grass waste, cardboard, mixed paper and other minor biomass materials The rich carbohydrate ... Design and Statistical Analysis Data reported are average of duplicate or triplicate runs A 95% confidence level was used for statistical analysis and assessing statistical differences between treatments...
- 41
- 554
- 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) for KK mutation SDS/PAGE and western ... data also have relevance for the biological roles of the TatAdCd and TatAyCy systems in B subtilis Here, we have shown that both the TatAdCd and TatAyCy systems are able to recognize and transport...
- 12
- 445
- 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase ... prepared from wheat embryos: plants apparently contain a suicide system directed at ribosomes Proc Natl Acad Sci USA 97, 559–564 Sawasaki, T., Hasegawa, Y., Tsuchimochi, M., Kamura, N., Ogasawara, ... (Fig 3A) , and the mRNA from this plasmid was translated in the presence of biotin and the enzyme The efficiency of biotinylation was evaluated by measuring the fraction that could be trapped by the...
- 7
- 330
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... further investigated Although the AGM region is considered the first site of definitive hematopoiesis, recent studies have indicated that the placenta acts as an additional extramedullary hematopoietic...
- 12
- 550
- 0
Civil liability resulting from transfrontier environmental damage: a case for the Hague Conference? pot
... See Draft Articles on the Law Applicable to Contractual and non-Contractual Obligations (1), The Japanese Annual of International Law No 39 (1996), and Draft Articles on the Law Applicable to ... information on the content and application of the different laws The law of the place of the damage (lex damni) The law of the place of the damage (lex damni) can also be protective of the plaintiff’s ... caused by the nuclear incident can also be exercised against the insurer or against any other person who has granted a financial guarantee to the operator, in accordance with Article 10 of the...
- 87
- 284
- 0
Help After a Disaster Applicant’s Guide to the Individuals & Households Program pdf
... properties are not available. Repair: Money is available to homeowners to repair damage from the disaster that is not covered by insurance. The goal is to make the damaged home safe, sanitary, and ... government and with State and local governments and voluntary organizations. What types of disaster assistance programs are available in a disaster? There are two primary Federal programs that offer disaster assistance: • FEMA’s Individuals and Households Program provides money and direct ... the applicant lived in at the time of the disaster is covered by insurance. Any damages reported at the time of the application for FEMA assistance should be covered by the applicantʹs insurance. FEMA cannot provide assistance which is available from another ...
- 33
- 414
- 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental ... we mean by management? [8] Chapter The classical definition of management, as also found on Wikipedia, is as follows: Management in all business areas and organizational activities are the acts ... taking a break due to family or medical issues Disturbances can be long drawn, like the SARS (a deadly virus that spreads in the air from human-to-human) threat that created a fear of travel among...
- 328
- 4,476
- 0
SAURASHTRA UNIVERSITY RAJKOT MASTER OF ARTS (ECONOMICS)CHOICE BASED CREDIT SYSTEM COURSE OF STUDIES SYLLABUS (A draft of CBCS courses in M.A., Economics submitted for Revision of Curriculum to be executed from ,June, 2010)ByDEPARTMENT OF ECONOMICS SA doc
... characteristics of the population have acquired importance and these have also been included in the framework of study Migration and urbanization are the characteristics of structural change taking ... establishes the functional relationship between the large aggregates The aggregate analysis has assumed such a great significance in recent times that a prior understanding of macroeconomic theoretical ... gender characteristics of the population have e acquire importance and these have also been included in the framework of study Migration and urbanization are the characteristics of structural change...
- 120
- 449
- 0
báo cáo hóa học: "Reliability and validity of pendulum test measures of spasticity obtained with the Polhemus tracking system from patients with chronic stroke" pot
... Methods Data analysis The Statistical Package for Social Sciences was used for all analysis Summary statistics were calculated These involved medians and minimum to maximum values for most measurements ... validity of the measures obtained with the system suggests little advantage of the area under the curve and velocity measures over the angle of first reversal measure That angle, also called the ... the field sensors, the tested leg was passively elevated to horizontal by one of the investigators Once relaxation was assured by palpation of the patellar tendon, free mobilization of the patella...
- 7
- 313
- 0
báo cáo hóa học: " The acute inflammatory response to intranigral a-synuclein differs significantly from intranigral lipopolysaccharide and is exacerbated by peripheral inflammation" pptx
... Mogi M, Harada M, Riederer P, Narabayashi H, Fujita K, Nagatsu T: Tumor necrosis factor-alpha (TNF-alpha) increases both in the brain and in the cerebrospinal fluid from parkinsonian patients ... prevented by dexamethasone, and not mimicked by rh-TNF-alpha, IL1beta and IFN-gamma J Neurochem 2002, 81:150-157 Ariza D, Lima MM, Moreira CG, Dombrowski PA, Avila TV, Allemand A, Mendes DA, Da Cunha ... and A beta(25–35) Journal of the American Chemical Society 2001, 123:5625-5631 Bonaiuto C, McDonald PP, Rossi F, Cassatella MA: Activation of nuclear factor-kappa B by beta-amyloid peptides and...
- 14
- 457
- 0
Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx
... LPN and AF contributed reagents and materials AFO supervised the research Further LPN and AF critically revised the manuscript and AF gave the final approval for publication All authors read and ... H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and (B) amino ... Europe are made public Methods Human samples A total of 234 Danish human nasal swab suspensions or nasopharyngeal aspirates positive for influenza A, from 1999 to 2006, were available at the WHO National...
- 19
- 579
- 0
báo cáo hóa học:" Rupture of the ilio-psoas tendon after a total hip arthroplasty: an unusual cause of radio-lucency of the lesser trochanter simulating a malignancy" pot
... the pelvis, and low demand of our patient, he was treated by physiotherapy and gait training At four years follow-up and almost 10 years after his THA, he still uses a cane for outdoor ambulation ... thickening and Figure An axial T2 MRI showing the fatty atrophy and retraction of the right ilio-psoas tendon (arrow) all the way to the level of the sacro-iliac joint Maheshwari et al Journal of ... Femoral and sciatic neuropathies after total hip arthroplasty Acta Orthop Scand 1980, 51:531-4 19 Wooten SL, McLaughlin RE: Iliacus hematoma and subsequent femoral nerve palsy after penetration...
- 5
- 265
- 0
báo cáo hóa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" doc
... Environmental Medicine 1997, 39(11):1111-1114 30 Shibata A, Oka K, Nakamura Y, Muraoka I: Recommended level of physical activity and health-related quality of life among Japanese adults Health and quality ... authors read and approved the final manuscript Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Health, Labor, and Welfare of Japan We gratefully ... freshmen of Osaka University- JJIAO 2008, 26(4):297-302 24 Fukuhara S, Bito S, Green J, Hsiao A, Kurokawa K: Translation, adaptation, and validation of the SF-36 Health Survey for use in Japan J Clin...
- 8
- 353
- 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf
... Gene amplified size (bp) 1,701 1,795 1,719 1,779 Primer sequence 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG ... expressing the Newcastle disease virus fusion protein Avian Dis 1992, 36, 858-870 19 Mori H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the ... Diagnostic Tests and Vaccines for Terrestrial Animals 6th ed pp 465-481, OIE, Paris, 2008 24 Ogawa R, Yanagida N, Saeki S, Saito S, Ohkawa S, Gotoh H, Kodama K, Kamogawa K, Sawaguchi K, Iritani...
- 8
- 315
- 0
Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt
... week at the same time during the day After the stabilization of the animals in o a warm box at 37 C for 15 min, the tail systolic blood pressure was measured with a non-invasive blood pressure system ... method Angiotensin I and II were measured with a rat angiotensin I and II EIA kits (Phoenix Pharmaceuticals, USA) according to the manufacturer’s instructions Urine was assayed for creatinine by a ... compared the consumption of an effective amount of NaCl plus KCl, NaCl, NaCl plus chitosan, and chitosan by SHRs in an effort to find a suitable agent for salting food that has saltiness of NaCl,...
- 6
- 406
- 1
Báo cáo lâm nghiệp:"The extreme drought in the 1920s and its effect on tree growth deduced from tree ring analysis: a case study in North China" ppsx
... around the typical steppe Thus, a tree-ring database covering a broad range of spatial and temporal scales may provide an alternative approach to assess and understand the stand dynamics of the ... rings at the base of the trees and at breast height, the actual age of trees was calculated by adding 10 years to the pith age at breast height The synchronization among the four chronologies was ... in 1994 by Zhang [57] XLPI and JGB samples were taken in 1994 and 1999 by the authors of this paper 2.2 Climatic data Climatic data in the Xilin River Basin were obtained from the nearby Xilin...
- 8
- 396
- 0
Báo cáo khoa học: "Late cutaneous metastases to the face from malignant pleural mesothelioma: A case report and review of the literature" docx
... Cinquegrana A, Faravelli B, De Palma M, Chessa L, Nicolò G, Serra M, Capaccio A, et al.: Malignant pleural mesothelioma Multivariate analysis of prognostic factors on 113 patients Anticancer Research ... CAM 5.2 and CD10 and focally with SMA and Calretinin The histopathological diagnosis was in keeping with Metastatic Mesothelioma of sarcomatous type Discussion Malignant Mesothelioma is a rare ... needle aspiration a case report Indian J Pathol Microbiol 2005, 48(4):482-4 Maiorana A, Giusti F, Cesinaro AM, Conti A, Rossi G: Cutaneous metastases as the first manifestation of pleural malignant...
- 5
- 451
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25