peptideprophet™ and asapratio™ analysis totals for peptides measured in all grr1δ vs wild type analyses top peptides assigned a peptide probability identified by peptideprophet™ as well as peptides whose relative abundance ratio wa
Data based system design and network analysis tools for chemical and biological processes
... protein and pathway data banks Search capabilities of a very large patent databases, in combinatorial chemistry can provide a vast array of molecules to determine combinations that have desirable ... Data processing: Increasing the prediction and computational performance of existing classification and regression techniques by optimal dimensional reduction of large scale datasets • Data classification: ... of online databases and repositories for sharing data and models (Appendix A) and development of syntactically and semantically sound ways of representing biological models, such as the Systems...
- 287
- 514
- 0
Integrated analysis of audiovisual signals and external information sources for event detection in team sports video
... fa- Ball and on domain Ball trajectory is obtained by jectory, and goalposts reasoning based on ball, ball tra- Goals are obtained from mid-level rules 77% 100% ment semantic entities are obtained ... classification performance by fusing multiple weak classifiers [31] When each feature was treated as a weak classifier, boosting was introduced to multimedia classification [87] Different from maximum ... similar to [56] 14 Yu et al [110] aimed to detect atomic actions in soccer: passing and touching of the ball, and further to derive goals Detection of passing and touching was based on ball trajectory...
- 164
- 397
- 0
Báo cáo khoa học: Proteoglycans in health and disease: new concepts for heparanase function in tumor progression and metastasis pptx
... heparanase in human cancer by focusing on head and neck carcinoma and multiple myeloma as examples of solid and hematological malignancies Heparanase in head and neck carcinoma: signaling in ... W, Nakamura Y, Tsujimoto M, Sato M, Wang X, Kurozumi K, Nakahara M, Nakao K, Nakamura M, Mori I et al (2002) Heparanase: a key enzyme in invasion and metastasis of gastric carcinoma Modern Pathol ... heparanase functions in health and disease is only starting to emerge Clearly, from activity implicated mainly in cell invasion associated with tumor metastasis, heparanase has turned into a multifaceted...
- 14
- 397
- 0
Báo cáo "Sensory Properties and Consumer''''s Preference for Fondue Cheeses in Hanoi''''s Market " pdf
... Bridel was a sweet aftertaste and stickiness ; Kiri was milk odor and lactic odor; La vache qui rit and Picon were fineness, elasticity, color, saltiness, salty aftertaste; Party cubes was butter ... was given All participants had answered a questionnaire about their age and gender Additionally consumption data were also collected on all respondents Statistical analysis The results were analyzed ... about 20 minutes and the break time was minutes The total duration of a session was 2,5h The average responses over replicates and assessors were used in the multivariate analyses (PCA, PLSR)...
- 7
- 461
- 0
Health workers'''' attitudes toward sexual and reproductive health services for unmarried adolescents in Ethiopia potx
... research interests include adolescent, and child and maternal health AAR worked with Haramaya University in Ethiopia as a lecturer and has involved in surveys, meta -analyses, trials and other large ... 3):S3 Paul VK, Sachdev HS, Mavalankar D, Ramachandran P, Sankar MJ, Bhandari N, Sreenivas V, Sundararaman T, Govil D, Osrin D, et al: Reproductive health, and child health and nutrition in India: ... planning of the study MT and AAR have involved significantly in the analysis and writing of the manuscript All authors read and approved the final manuscript Authors’ information MT holds an...
- 7
- 722
- 0
Báo cáo hóa học: " Preamble and pilot symbol design for channel estimation in OFDM systems with null subcarriers" pdf
... frequency-selective fading channels We assume that the discrete-time baseband equivalent channel has FIR of maximum length L, and remains constant in at least one block, i.e., is quasi-static The channel impulse ... band, and one is the central null (DC) subcarrier Of the 200 used subcarriers, subcarriers are allocated as pilot symbols, while the remaining 192 subcarriers are used for data transmission In ... compare frequency-domain channel MSE h obtained by the l and l ∞ norm-based design with the standard IEEE 802.1 1a preamble By varying the channel length L, from to 16, we numerically obtain the...
- 17
- 472
- 0
Báo cáo hóa học: " Research Article Weak and Strong Convergence Theorems for Nonexpansive Mappings in Banach Spaces" pot
... Fixed Point Theory and Applications for fixed points of nonexpansive mapping T in Banach space and also prove weak and strong convergence theorems Moreover, we introduce an implicit iteration scheme: ... mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol 202, no 1, pp 150–159, 1996 J Gornicki, “Weak convergence theorems for asymptotically nonexpansive mappings in ... the approximation of fixed points of nonexpansive mapping and common fixed points of a finite family of nonexpansive mappings, respectively Now, we give some definitions and lemmas for our main results...
- 7
- 289
- 0
Báo cáo nghiên cứu nông nghiệp " Design and implementation and scientific and financial analysis of 12 Sunflower trials in Vietnam " pot
... soil was acid, organic matter was high, available N, P2O5, K2O was very low and exchangeable Ca, K and Mg content were low Cation exchangeable capacity and the base saturation were both low Table ... Ferralsol soil of Bao Loc was typical of this region This soil was acid, organic matter was high, available N, P2O5, K2O was very low and exchangeable Ca, K and Mg content were low Cation exchangeable ... (Sowing from the middle to the end of August and harvest in November and December) was the optimal season to grow sunflower in Lam Dong province as rainfall was well distributed and irrigation...
- 21
- 359
- 0
Báo cáo hóa học: " Research Article An Analysis Framework for Mobility Metrics in Mobile Ad Hoc Networks" ppt
... some random mobility model In this case, link residual time and link duration are random variables Consequently, the network average link residual time and link duration are also random variables ... et al [20] give an approximate calculation for link duration and path duration for a random waypoint mobility model In this paper, we determine an exact expression for the PMF of node separation ... requirement that the path (link) may disappear and reappear during the wait time in the case of availability, but may not so in the case of persistence The remaining metrics are measured in units...
- 16
- 268
- 0
Báo cáo hóa học: " WEAK AND STRONG CONVERGENCE THEOREMS FOR NONEXPANSIVE SEMIGROUPS IN BANACH SPACES SACHIKO ATSUSHIBA AND WATARU TAKAHASHI " doc
... 3rd International Conference on Nonlinear Analysis and Convex Analysis (W Takahashi and T Tanaka, eds.), Yokohama Publishers, Yokohama, 2004, pp 9–16 S Atsushiba, N Shioji, and W Takahashi, Approximating ... Department of Mathematics, Shibaura Institute of Technology, Fukasaku, Minuma-ku, Saitama-City, Saitama 337-8570, Japan E-mail address: atusiba@sic.shibaura-it.ac.jp Wataru Takahashi: Department ... nonexpansive non-linear mappings in Banach spaces, Arch Ration Mech Anal 24 (1967), 82–90 , Nonlinear operators and nonlinear equations of evolution in Banach spaces, Nonlinear Functional Analysis (Proc...
- 12
- 286
- 0
báo cáo khoa học: "P-loop mutations and novel therapeutic approaches for imatinib failures in chronic myeloid leukemia" pps
... 94% in imatinib-intolerant patients) and overall survival was 94% (92% in imatinib-resistant and 100% in imatinib-intolerant patients) [26] Marked activity also was noted in advanced disease ... Initial approval of dasatinib was based on data from the START (SRC/ABL Tyrosine kinase inhibition Activity: Research Trials of dasatinib) program, a series of multicenter, open-label phase clinical ... the ABL kinase domain, the contact site, the SH2 binding site (activation loop), and the catalytic domain [14] Approximately 85% of all imatinib-resistant mutations are associated with amino acid...
- 9
- 300
- 0
báo cáo khoa học: " Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes" docx
... vun_cand053 GUAAUUGAGUUAAAAGGACUAUAU 43 cellulose synthase/transferase vun_cand052 vun_cand055 CGAGAGCCACUCGCCUAAGCGA CCACUGUAGUAGCUCUCGCUCA 34 30 55 40 0 0 vun_cand054 AGCAAGUUGAGGAUGGAGCUU 48 231 ... generate ~700 μg of RNA Pooled total RNA was resolved in a 15% denaturing polyacrylamide gel and the 20-30 nt small RNA fraction was extracted and eluted A preadenylated adaptor (linker 1, IDT) was ... Target Drought 942 1546 vun_cand048 UGGUCUCUAAACUUUAGAAAUGAA 746 263 vun_cand036 UCAGAGGAAACAACACUUGUAC 59 23 0 vun_cand045 CGUGCUGAGAAAGUUGCUUCU 52 79 14 VTC2 (vitamin c defective 2) vun_cand053...
- 11
- 391
- 0
báo cáo khoa học: " Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein" pps
... used immediately for assays or stored at -80°C Ascorbate and glutathione were extracted and assayed following the method developed by Queval and Noctor [119] ATP and ADP were assayed as previously ... isolation, microarray experiments and statistical analysis of data, quantitative real-time PCR; LC and RB conceived the study and participated in its design and coordination All authors read and approved ... whereas wild- type plants took days before an increase was detectable and the amplitude of the signal was far lower (Figure 2D) It has been reported that the chloroplast can control the rate of transcription...
- 22
- 475
- 0
Báo cáo y học: " A systematic review and meta-analysis of neurological soft signs in relatives of people with schizophrenia" ppsx
... such comparative studies are not well indexed; therefore a search strategy was generated empirically by examining the indexing of relevant papers from the authors’ personal databases and from ... synthesis The data were analysed using Comprehensive MetaAnalysis version 2, a dedicated meta -analysis programme (BioStat, Inc, Englewood, NJ) The analysis was based on all included studies and consisted ... search strategy was designed to be sensitive rather than specific, and was applied to the following databases: EMBASE, OVID-MEDLINE and PsycINFO The sensitivity of the search was confirmed by...
- 8
- 559
- 0
báo cáo khoa học: " Plastid chaperonin proteins Cpn60α and Cpn60β are required for plastid division in Arabidopsis thaliana" docx
... in wild type, indicating that the transit peptide was cleaved and the protein was imported into plastids Both in E coli [26] and A thaliana chloroplasts (Figure 4B), normal FtsZ ring formation ... total protein extracted from whole plants was examined, the intensity of the band was reduced in the ptcpn60β1-1 mutant (br04) relative to that in the wild type However, a residual band was detected, ... construct, a genomic fragment containing the annotated ARC2 open reading frame flanked by 1.2 kb at the 5' end and 0.4 kb at the 3' end was amplified by PCR using the primers 5'-CGTTTCAATCACAACCACTCA-3'...
- 12
- 266
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
... PEAMT -For5 'TTGCCCTTGAG CGTTCTATT, Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ -For5 'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH -For5 ' TGGAAAATTGCTCCAGCTCT, ... SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3 Proc Natl Acad Sci USA 2002, 99:8436-8441 Mahajan S, Pandey G, Tuteja N: Calcium and Salt Stress Signaling in Plants: ... 1"-phosphate) processing enzyme family protein, eukaryotic elongation factor 1A and valyl tRNA synthetase involved in transcription, mRNA and tRNA processing and translation was greatly increased in response...
- 25
- 292
- 0
Báo cáo y học: "Community-based DOTS and family member DOTS for TB control in Nepal: costs and cost-effectiveness" doc
... collection, participated in the analysis and preparation of the manuscript; ATG designed the study, advised on and participated in the data collection and analysis and participated in the preparation ... the CBD strategy and family members in the FBD strategy) Measures to minimise recall bias by patients and their supervisors included triangulation of data between patients and their treatment supervisors, ... of annual salary of staff attributable to TB Salary rate for this category of staff (net salary per day) × annual days attributable to TB Facility financial records Semi-structured questionnaire...
- 8
- 251
- 0
Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps
... regulated Acknowledgements We thank David Raizen, Namni Goel and Amita Sehgal for critical reading of the manuscript; Michael Farias and Adetoun Adeniji-Adele for technical assistance This work was ... data processing and clustering analysis KW and OV conducted bioinformatics analysis on the diurnal genes and comparative analysis with other publications SH performed transcription factor binding ... using the atlas of Franklin and Paxinos as a reference [47] After removing the olfactory bulb, the most anterior mm cortical area was cut as part of the prefrontal cortex Then the coronal brain...
- 15
- 299
- 0
akle - 2011 - the relationship between cg and financial reporting timeliness for companies listed in egyptian
... the same standards and application by completely and there are standards Inapplicable on practically Although they are found in the generated laws Of the companies and the financial market, and ... (2001) allemande disclosure of rules that depend on the principal of every investors has the accessing right of the financial information in any timeliness and at after preparing the financial reporting ... accounting information quality which the financial accounting standards board statement No.(2) And the characteristics of financial report quality 82 Internal Auditing & Risk Management _ Anul...
- 10
- 340
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25