pda esi ms ms detection of polymethoxylated flavones in highly degraded citrus juice a quality control case study
Báo cáo y học: "Cerebral microdialysis for detection of bacterial meningitis in aneurysmal subarachnoid hemorrhage patients: a cohort study" pptx
... the brain [10] A trial evaluating the permeability of antibiotics across the blood-brain barrier showed an increase in cerebral lactate and glutamate, and a slight increase in glycerol towards ... significant but late elevations in the excitatory amino acids aspartate and glutamate as well as in the inhibitory neurotransmitters γ-amino butyric acid and taurine were Available online http://ccforum.com/content/13/1/R2 ... lactate/glucose ratio meningitis aneurysmal subarachnoid haemorrhage (SAH) and bacterialin patients Cerebral extracellular glucose and lactate/glucose ratio in patients with with aneurysmal subarachnoid haemorrhage...
- 9
- 323
- 0
Báo cáo y học: " Dynamics of mitochondrial heteroplasmy in three families investigated via a repeatable re-sequencing study" doc
... desirable An alternative approach is to run a Galaxy instance locally (see [33] for details) Galaxy can easily be installed on a variety of platforms, and workflows can be moved between Galaxy instances ... processing are not available as supplementary material We emphasize that in highlighting these deficiencies we are not being critical of these authors, as making data, tools, and research metadata ... Data The 32 Illumina datasets representing the three families as well as the pUC18 re-sequencing data are available at Galaxy [18] in addition to being deposited in standard Page 10 of 16 repositories...
- 16
- 439
- 0
Báo cáo y học: "Chronicity of sleep problems in children with chronic illness: a longitudinal population-based study" pdf
... illness and sleep problems In general, logistic regression analysis is considered a robust and appropriate analysis also in non-normal data Both unadjusted (crude) analyses, as well as separate analyses ... without medical verification of the diagnosis Difficulties initiating or maintaining sleep were assessed by a joint variable, making it difficult to examine each construct separately and to assess ... National Data Inspectorate and the Regional Committee for Medical and Health Research Ethics in western Norway Written informed consent was obtained from all parents included in this study Participants...
- 7
- 335
- 0
Tài liệu Báo cáo khoa học: "Automatic Detection of Nonreferential It in Spoken Multi-Party Dialog" doc
... feature generation methods could propagate into the model that was learned from the data The advantage of this approach is, however, that training and test data are homogeneous A model trained ... 65 58 Table 1: Classification of it by two annotators in a corpus subset Automatic Classification 4.1 4.1.1 Training and Test Data Generation Segmentation We extracted all instances of it and the ... this information is used in a similar way as sentence boundary information All of the features described in the following were obtained fully automatically That means that errors in the shallow...
- 8
- 436
- 0
Detection of Pseudomonas aeruginosa in sputum headspace through volatile organic compound analysis potx
... Multivariate data analysis All data was evaluated using multivariate data analysis techniques, including Principal Component Analysis (PCA) and Partial least-squares discriminant analysis (PLS-DA) ... Data preprocessing steps included mean centering and weighing of all variables by their standard deviation to give them equal variance In order to evaluate every dataset before analysis, a PCA ... endtidal breath phase by quantification of water vapour in breath samples while the soft ionization technique allows easy analysis of high moisture samples such as breath IMS has the disadvantage of...
- 9
- 904
- 0
R"eCseoarcuh garthicl eofficer screening" improves detection of pulmonary tuberculosis in hospital in-patients pptx
... data-analysis and the data are all retrieved from Infectious Control Databank of Changhua Christain Hospital All the data is decoding and managed in compliance with the Helsinki Declaration and ... Nanshiao Road, Changhua, Taiwan, 3Infection Control Committee, Changhua Christian Hospital, 135 Nanshiao Road, Changhua, Taiwan and 4Department of Nursing, Changhua Christian Hospital, 135 Nanshiao ... Department of Internal Medicine, Changhua Christian Hospital, 135 Nanshiao Road, Changhua, Taiwan, 2Division of Infectious Disease, Department of Internal Medicine, Changhua Christian Hospital,...
- 7
- 451
- 0
ag doped wo3-based powder sensor for the detection of no gas in air
... simulation results indicate that the capacitance and the contact resistance (Ra) of the Ag/ WO3 were only marginally altered to a small extent but the main change was in its granular/inter-granular ... Impedance analysis has been increasingly used to characterize the inter-granular particles and interface phenomena It has been found that the simultaneous measurement of resistance and capacitance ... sensor material in the parallel mode) are also presented in Fig It is interesting to note that when 40 ppm NO in air mixture was passed over the sensor, the impedance of the material was dramatically...
- 8
- 502
- 0
Báo cáo " On the detection of gross errors in digital terrain model source data " pdf
... Project area Height of surface / Std. deviation Number of data points Spatial distribution of data points Average distance between data points Number of data points with intentional gross error ... error of source data or variation of topography. 2.1. Test data This research uses two sets of data: one is the DEM project in the area of old village of Duong Lam (Son Tay Town, Ha Tay Province); ... intentional gross error Magnitude of intentional gross errors Load data Generate random gross errors Create a moving window arround point Pi Estimate height of Pi Compute statistics within the moving window...
- 7
- 379
- 0
The bleach method improves the detection of pulmonary tuberculosis in Laos ppt
... for Health Research Data analysis Data were entered using Epi Data 3.1 (Centers for Disease Prevention and Control, Atlanta, GA, USA) and analysed using Stata 8.0 (StataCorp, College Station, ... to a number of objections in the literature against its use in routine microscopy for pulmonary TB.12 Although the often-mentioned lack of standardisation and quality assurance are unacceptable ... 1552 and 123 sputum samples, i.e., an average of 2.7 samples per patient The male/female ratio was 0.57, the mean age was 57 years (range 5–92), and 98% of patients were sampled for TB case detection...
- 6
- 394
- 0
Báo cáo hóa học: " Detection of epithelial apoptosis in pelvic ileal pouches for ulcerative colitis and familial adenomatous polyposis" pot
... fact that both inflammatory and apoptosis pathways are related Furthermore, the major pathway of apoptosis in these cases were intrinsic mitochondrial pathway characterized by APAF-1 and Caspase-9 ... of inflammatory bowel disease after ileal pouch-anal anastomosis Ann Surg 1990, 211(5):622-629 Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients with extraintestinal manifestations have a higher ... LAV participated in its design and performed the statistical analysis CSRC participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final...
- 6
- 407
- 0
Báo cáo khoa học: "Detection of Lawsonia intracellularis in diagnostic specimens by one-step PCR" pot
... for analysing the accuracy of macroscopic ability to detect pig with PPE and the availability of the PCR assay for screening the prevalence of L intracellularis infection in the pig farms Macroscopic ... pigs diagnosed as PPE by macroscopic examination were used to determine the accuracy of the PCR assay for the detection of L intracellularis infection (Table 1) Mucosal scraping and fecal samples ... Multiplex polymerase chain reaction for simultaneous detection of Lawsonia intracellularis, Serpulina hyodysenteriae, and salmonellae in porcine intestinal specimens J Vet Diag Invest 1997, 9,...
- 5
- 288
- 0
Báo cáo khoa học: "Use of soft X-radiography for early non-destructive detection of floral differentiation in Douglas fir buds" pptx
... buds was clearly apparent (fig 3) In addition, it was possible to characterize the female buds by the flatness of their apparent apical dome (meristem and bracts of floral part) The images in figure ... from a small percentage on August (2-30) to almost the total number of buds on September (table II) The date of floral transformation of some of the buds in these radiographs was estimated as being ... could be an additional criterion in the interpretation of radiographs made at a very early stage DISCUSSION AND CONCLUSION is commonly used to deterquality of different seed samples (Chavagnat, 1984)...
- 9
- 241
- 0
Báo cáo y học: "Conventional radiography requires a MRI-estimated bone volume loss of 20% to 30% to allow certain detection of bone erosions in rheumatoid arthritis metacarpophalangeal joints" ppsx
... data, analysis of data and interpretation of data and writing the manuscript AaV: acquisition and analysis of data SJ: interpretation of data and drafting the manuscript HST: acquisition and analysis ... and analysis of data MØ: study design, analysis of data and interpretation of data and writing the manuscript Acknowledgements Amersham Health The Danish Rheumatism Association References Arnett ... of cm Merge eFilm™(Milwaukee, Wisconsin, USA) workstation, a commercially available software package, was used for the readings of the MRI images This software enables digital image viewing and...
- 4
- 356
- 0
Báo cáo khoa học: "Detection of somatostatin receptors in human osteosarcoma" pot
... Helman LJ: A randomized controlled trial of octreotide pamoate long-acting release and carboplatin versus carboplatin alone in dogs with naturally occurring osteosarcoma: evaluation of insulin-like ... Osteosarcoma somatostatin negative Magnification ×400 Osteosarcoma somatostatin negative Magnification ×400 This case of an osteosarcoma had no somatostatin receptors Immunohistochemistry staining ... hormone and somatostatin affects the growth of osteosarcoma in animal models [8-10] There is also one study in pediatric patients having metastatic osteosarcoma treated with somatostatin analogue...
- 5
- 288
- 0
Báo cáo y học: "Detection of bone erosions in rheumatoid arthritis wrist joints with magnetic resonance imaging, computed tomography and radiography" ppt
... evaluated CT images, and gave substantial input to data evaluation and manuscript preparation All authors read and approved the final manuscript Acknowledgements The Danish Rheumatism Association ... al omy of the wrist is much more complicated than that of the metacarpophalangeal joints, and many of the small carpal bones have irregular margins with indentations (for example, at the attachment ... apart The mean value of volumes obtained at reading A and B was used for the comparison of CT and MRI volumes *P < 0.01 aIntramodality agreement, reading A minus reading B; intermodality agreement,...
- 8
- 372
- 0
Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps
... DNA of Pseudomonas poae, Delftia acidovorans, and Burkholderia cepacia A detailed sequence analysis of the PCR-positive samples of ReA and UA patients revealed a number of DNA of bacteria that ... and rheumatological data analyses BJ and JS participated in the design and coordination of the study, and drafted the manuscript MR has assisted in writing the manuscript AH and AS analyzed microbiological ... Ct-IgA antibodies by ELISA (Labsystems, Hilsinki, Finland) cChlamydia PCR in genital swabs was determined by Cobas Amplicor PCR assay (Roche Diagnostics Molecular Systems, Inc, CA, USA) dHLA-B27...
- 11
- 461
- 0
báo cáo khoa học: "Electrophoretic detection of interspecific hybrids in Parnassius (Lepidoptera Papilionidae)" docx
... apollo »-allele at the three other discriminating loci (n&dquo; 4, table 3) This finding was a surprise, since this individual had morphological characteristics of a pure apollo Among the at all four ... 1976) UILLAUMIN the - In any case, our observations once again demonstrate the dynamic nature of the process The remaining interesting case is whether the observed gene flow among these populations ... sphragis and therefore mated Laboratory bred females appear to suffer from the same abnormality as the natural hybrids, while males are normally fertile (DESC!MON et al., in preparation) In spite of...
- 6
- 214
- 0
Báo cáo y học: "Effective detection of rare variants in pooled DNA samples using Cross-pool tailcurve analysis" ppsx
... defined as the ratio of the sum of Phred quality scores of the variant base call to the sum of Phred quality scores of all base calls; (3) average quality, defined as the average quality of all ... Effective detection of rare variants in pooled DNA samples using Cross-pool tailcurve analysis Tejasvi S Niranjan1,2,*, Abby Adamczyk1,*, Hector Corrada Bravo3,4,*, Margaret A Taub5, Sarah J Wheelan5,6, ... strategy, we present data from sequencing 12 indexed libraries of 40 samples each (total of 480 samples) using a single lane of a GAII Illumina Sequencer We utilized an alternative base-calling...
- 51
- 410
- 0
báo cáo khoa học: " Successful application of technetium-99m-labeled octreotide acetate scintigraphy in the detection of ectopic adrenocorticotropin-producing bronchial carcinoid lung tumor: a case report" pot
... defects, but a spiral abdominal CT scan revealed bilateral adrenal hyperplasia The clinical and imaging findings raised suspicion of an ACTH-producing tumor A bronchoscopy and alveolar lavage was performed ... participated in the design and coordination of the study, drafting the manuscript and interpreting the radiological figures MC participated in the design and coordination of the study, drafting the manuscript ... 74:108-110 Tsagarakis S, Christoforaki M, Giannopoulou H, Rondogianni F, Housianakou I, Malagari C, Rontogianni D, Bellenis I, Thalassinos N: A reappraisal of the utility of somatostatin receptor scintigraphy...
- 4
- 328
- 0
Báo cáo y học: " Collection by trained pediatricians or parents of mid-turbinate nasal flocked swabs for the detection of influenza viruses in childhood" doc
... antisense CAAAGCGTCTACGCTGCAGTCC, probe fam-TTTGTGTTCACGCTC ACC GTGCC-bhq1; influenza B, sense GAGACACAATTGCCTACCTGCTT, antisense TTCTTTCCCACCGA ACCAAC, probe tet-AGAAGATGGAGAAGG CAAAG CAGAACTAGC-eclipse; ... CGGGTGCCTTTTACAAGAAC, antisense TTCTTTCCTCA ACCTCG TCC, probe vic-ATGCAAGGGCCAATTCTTCCAAG TT-bhq1 Influenza A and B RNA were quantified relatively; the criterion for a positive reaction was a cycle ... delivered to the laboratory, each patient's paired samples were processed in parallel Viral Page of RNA was extracted from both swabs by means of a Nuclisens EasyMAG automated extraction system (Biomeriéux,...
- 4
- 212
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25