pats validation of eliciting doses using a novel single dose challenge protocol
Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx
... proteins ELISA Figure (A) The map of dominant immunoreactive areas of ORF2 The amino acid residues of each area are identified (B) The ORF2 fragment that spans from amino acid 113 to 147 was amplified ... positive sera by GST-ORF2-E ELISA A negative-positive threshold for each assay was calculated using the Microsoft Excel spreadsheet Evaluation of assay repeatability Ten negative serum samples and 10 ... significant false-positive in IFA Moreover, as Nawagitgul et al reported [13], evaluating a newly developed assay by comparison with a widely used assay is not an absolute standard of comparison...
- 7
- 420
- 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... with an argon ion laser Acquired images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) A stock solution (1 mm) of DBZTC ... salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade, and double-distilled water was used throughout RAW264.7 cells were from American ... determination of aluminium using thermal lens spectrometry Anal Chim Acta 250, 95–104 Yi XF & Ben GY (2000) Seasonal variation in antioxidants of Polygonum viviparum and its relation to solar radiation...
- 9
- 401
- 0
Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx
... current anthrax vaccine (Anthrax Vaccine Adsorbed -AVA) due to adverse side effects observed in a large percentage of volunteers This revocation of available vaccine has left healthcare workers, laboratory ... goat anti-sera Cell viability determined by an MTT-based assay A Anti-PA83 IgG Data shown are the average ± SEM of five assays each with four replicates EC50 is 2.57 × 10-7 M B Anti-PA83 F(ab')2 ... Casadevall A, Dadachova E, Pirofski LA: Passive antibody therapy for infectious diseases Nat Rev Microbiol 2004, 2:695-703 Casadevall A: Passive antibody administration (immediate immunity) as...
- 8
- 312
- 0
Báo cáo y học: " Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye" pps
... AG /CAA AAC CTC AGC AAA TAT ATG AG 554 bp N /A Custom 95°C initial denaturation for 10 mins; 55°C annealing BG-1F TAG CAA CCT CAA ACA GAC ACC A 247 bp BG-1R BHRF-1 Amplicon Length CAG CCT AAG GGT ... plasma of nasopharyngeal carcinoma and lymphoma patients Cancer Res 2003, 63(9):2028-32 43 Lin JC, et al: Quantification of plasma Epstein-Barr virus DNA in patients with advanced nasopharyngeal ... 58°C annealing 208 bp AJ507799 (42105-42312) Custom 98°C initial denaturation for 13 mins; 60°C annealing CTA TAT GTC TGC TTA CTC CGG CG /G GAG ATA CTG TTA GCC CTG CGC CGG AGT AAG CAG ACA TAT AG...
- 11
- 323
- 0
Báo cáo y học: "Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray" pps
... obtained using two-way blastp [44] searches of Additional data files The following additional data are available with the online version of this paper Additional data file is a table of P values ... table of RMA values (in log scale) for all probe sets from all hybridizations Additional table is a figure of the RT-PCR validation of the microarray results Additional data file is a figure of ... Analysis of (in log RT-PCR validation scale) for methods RMA and all materials andectopically study valuesfor the of the microarray results CalculationdataOR overlap allmethods Click here for of genes...
- 10
- 261
- 0
Báo cáo y học: " Phylogenetic classification of Escherichia coli O157:H7 strains of human and bovine origin using a novel set of nucleotide polymorphisms" pps
... Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H: Complete genome sequence of ... O157 characterizations, culture, and DNA isolations, and analyzed 454 GS FLX and MALDI-TOF results Additional data files The following additional data are available with the online version of this ... O157:H7 strains in cattle Proc Natl Acad Sci USA 1999, 96:13288-13293 Ohnishi M, Terajima J, Kurokawa K, Nakayama K, Murata T, Tamura K, Ogura Y, Watanabe H, Hayashi T: Genomic diversity of enterohemorrhagic...
- 12
- 242
- 0
DSpace at VNU: Rapid and Simple Colorimetric Detection of Escherichia coli O157:H7 in Apple Juice Using a Novel Recombinant Bacteriophage-Based Method
... Fujisawa, T., Sata, S., Aikawa, K., Takahashi, T., Yamai, S., and Shimada, T 2000 Modification of sorbitol MacConkey medium containing cefixime and tellurite for isolation of Escherichia coli ... 100 H A. has HOANG AL apple juice beenET reported Steele et al., 1982; Besser et al., 1993 and Cody et al., 1999 The application of bacteriophages for detection of specific bacteria is advantageous ... Brigati, J R., and Sayler, G S 2008 Bacteriophage-amplified bioluminescent sensing of Escherichia coli O157:H7 Anal Bioanal Chem., 391, 507-514 Spinazzi, M., Casarin, A. , Pertegato, V., Salviati,...
- 5
- 191
- 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy of ... software, version 15 (SPSS, Inc., Chicago, IL) Clinical data were expressed as the median ± the standard error of mean (minimum-maximum) The non-parametric Kruskal Wallis variance analysis was ... findings are also based on the result of macroscopic and histopathological examinations However, biochemical data would elucidate physiopathological changes associated with pleural adhesion and the...
- 7
- 453
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients Surgical times varied based on the number of joints ... medial branch, Staender et al 17 reported a mean VAS pain score reduction of 3.3 at six months follow-up; 40% of patients had relief for at least 12 months, and mean duration of pain relief was ... results durable for at least years Larger scale trials with a control group are warranted to further evaluate the relative efficacy of this surgical treatment in patients with facet joint disease 123...
- 4
- 599
- 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... (2002) A novel interaction partner for the C-terminus of Arabidopsis thaliana plasma membrane H+-ATPase (AHA1 isoform): site and mechanism of action on H+-ATPase activity differ from those of 14-3-3 ... representative of three giving similar results 5865 Interaction between plasma membrane H+-ATPase and PPI1 Fig Stimulation of A thaliana PM H+-ATPase activity as a function of the concentration of ... activity was evaluated as the difference between total activity and that measured in the presence of 100 lm vanadate (less than 10% of total activity at pH 7; less than 5% of total activity at pH...
- 8
- 629
- 0
Tài liệu Báo cáo khoa học: "Sense-based Interpretation of Logical Metonymy Using a Statistical Method" pdf
... -22.37 Table 1: Interpretations of Lapata and Lascarides (2003) for finish video Lapata and Lascarides (2003) extend Utiyama’s approach to interpretation of logical metonymies containing aspectual ... European Chapter of the ACL, pages 168–177, Utrecht M Lapata and A Lascarides 2003 A probabilistic account of logical metonymy Computational Linguistics, 29(2):261–315 A Lascarides and A Copestake ... interpretations similar to the one of Lapata and Lascarides Our method consists of the following steps: • Step Use the method of Lapata and Lascarides (2003) to obtain a set of candidate interpretations...
- 9
- 429
- 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
... mm tall) The bottom of this chamber was a single layer of acoustically transparent latex A single layer of acoustically transparent polypropylene mesh was held in place approximately cm above ... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison...
- 15
- 967
- 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... CGGGGATCCGCATCGGAACAAAACAATAC AATCCCGGGTTACTTTAGTTTATCTTTGCCG GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC ... CCCAAGCTTGATGATGTCAGC CCCAAGCTTGAACGCCTTCATAGTGTC BamHI SmaI BamHI SmaI BamHI SmaI BamHI SmaI a Restriction sites used for cloning are shown in italic b Nucleotides changed for site-directed mutagenesis...
- 13
- 514
- 0
Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot
... since it is a language-independent algorithm English Phrase: Arabic Phrase: the advisory committee Alljnp AlAst$Aryp Task: stem AlAst$Aryp Choices AlAst$Aryp AlAst$Aryp AlAst$Aryp AlAst$Aryp Score ... tend to be translated into distinct words 1.1 Arabic details In this paper, Arabic was the target language but the approach is applicable to any language that needs affix removal In Arabic, unlike ... Our approach is based on the availability of the following three resources: • a small parallel corpus • an English stemmer • an optional unannotated Arabic corpus Our goal is to train an Arabic...
- 8
- 424
- 0
Báo cáo khoa học: "Fast Semantic Extraction Using a Novel Neural Network Architecture" docx
... labeled for each particular verb as so-called frames Additionally, semantic roles can also be labeled with one of 13 ARGM adjunct labels, such as ARGM-LOC or ARGM-TMP for additional locational ... because PropBank was built by labeling the nodes of a hand-annotated parse tree, pernode accuracy is usually reported in papers such as (Pradhan et al., 2004) Unfortunately our approach is based ... image recognition problems it is common to create artificial training data by taking into account invariances in the images, e.g via rotation and scale Such data improves generalization substantially...
- 8
- 302
- 0
Báo cáo khoa học: "Part of Speech Tagging Using a Network of Linear Separators" pdf
... this task Finally, we compare our approach to a stateof-the-art tagger, based on Brill's transformation based approach; we show that SNOWbased taggers already achieve results that are comparable ... training data, and will allow the algorithm to adapt to the new context For example, a language acquisition system with a tagger trained on a general corpus can quickly adapt to a specific domain, ... f a d a p t a t i o n : Performance of the tagger network with no adaptation(noadp-SNOW), baseline adaptation(SNOH0, and true adaptation(adp- SNOW) One difficulty in applying the SNOW approach...
- 7
- 367
- 0
Báo cáo khoa học: "PART-OF-SPEECH TAGGING USING A VARIABLE MEMORY MARKOV MODEL" doc
... sections, any finite memory Markov model cannot capture the recursive nature of natural language The VMM can accommodate longer statistical dependencies than a traditional full-order Markov model, ... is cheaper than the added complexity of an automaton with state "HVZ*" We in fact lost some accuracy in tagging because of the optimization criterion: Several "-ed" forms after forms of "have" ... estimate the probability of tag conversion to find an adequate smoothing scheme Open and closed classes differ in that words often add a tag from an open class, but rarely from a closed class...
- 7
- 299
- 0
Monetary Policy in the Eurozone: Evaluating the European Central Bank’s interest rate decisions and the needs of member states using a Taylor rule ppt
... country has a number of implications Martin Feldstein argues, with claims based on 1999 data, that “monetary policy that was too expansionary for Spain and Ireland, causing a substantial acceleration ... Bergsten and Kirkegaard 2012 Shambaugh 75 Shambaugh 76 Shambaugh 77 Shambaugh 11 78 Shambaugh 17 79 Shambaugh 13 80 Shambaugh 17 81 Shambaugh 29 74 Srivangipuram 28 As these crisis are in some way ... Claude and Papell, David H “CONVERGENCE OF EURO AREA INFLATION RATES.” (Bank of France Working Papers 2011) 14 De Haan, Jakob “Inflation Differentials in the Euro Area: A Survey.” (The European...
- 41
- 513
- 0
báo cáo hóa học: " Reduced inclination of cervical spine in a novel notebook screen system - implications for rehabilitation" docx
... performed the analysis and interpretation of the data MFS, SU, KV, SM, BK: Participation in the analysis of data, revision of the manuscript All authors read and approved the final manuscript Received: ... changes in the intradiscal pressure (PID) It has been suggested that an increased PID may worsen the alimentary status of the intravertebral disc that might contribute to a faster advancing of ... musculoskeletal disease a global perspective Clinical rheumatology 2006, 25:778-781 Kambin P, Abda S, Kurpicki F: Intradiskal pressure and volume recording: evaluation of normal and abnormal cervical disks...
- 6
- 536
- 0
báo cáo hóa học:" Study of the collagen structure in the superficial zone and physiological state of articular cartilage using a 3D confocal imaging technique" pptx
... superficial layer of AC has been reported to lead to rapid wear of the AC, and consequently reduction of the loading capacity of AC as a result of progressive release of proteoglycans from the cartilage ... scholarships from the University of Western Australian (UWA), the fellowship of National Healthy and Medical Research Council of Australia, Ms Salavica Pervan in School of Pathology of UWA for ... (ICRS Grade the shownapproximately half of aged cartilage specimens (from cadaver femoral heads) with littledirection spatially oblique to0, (A) surface (A) In approximately half of aged cartilage...
- 11
- 475
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008