... Hát mừng Dân ca H- rê Đặt lời: Lê Toàn Hùng - GV giới thiệu tên hát, tên tác giả, nội dung - HS ý lắng nghe hát - Cho HS nghe băng hát mẫu GV vừa đệm - HS nghe băng mẫu nghe đàn vừa hát GV hát ... bảng phụ - Giới thiệu hát, tác giả, nội dung hát Hoạt động học sinh - HS ý lắng nghe - Hs luyện - Xem tranh minh họa - Quan sát bảng phụ - Nghe Gv giới thiệu hát, tác giả - Cho HS nghe băng hát ... phách: Cùng múa hát nào, cất tiếng ca x x xx x x xx - Hướng dẫn HS vận động nhịp nhàng theo nhịp ( nhún chân, nghiêng người sang trái sang phải ) Củng cố - Dặn dò: - GV hỏi HS tên hát, tác giả hát...
Ngày tải lên: 08/11/2013, 05:11
... 2¢,3¢ ,4 ,5 71.2 40 .5 (1¢,3¢) 1¢ 72.7 41 .6 (2¢ ,4 ) 71.7 41 .6 (3¢) 5. 1 5 40 .2 (5 ) 65. 0 40 .6 (4 ) 4. 5 4 1¢,3¢ ,4 ,5 1¢,2¢ ,4 ,5 1¢,2¢,3¢ ,5 1¢,2¢,3¢ ,4 gave a pattern of four lines, consisting of ... eubacterial genomes, 45 fully sequenced archaeal genomes and 15 fungal genomes from GenBank using the NCBI server with default settings for all input parameters (http://www.ncbi.nlm.nih.gov/ sutils/genom_table.cgi) ... 8.0) and 0 .4 mgÆmL)1 protein at 10 000 g (A aeolicus) or 12 50 0 g (C glabrata) and °C Boundary sedimentation experiments were performed at 55 000 g and 20 °C using a solution containing buffer...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: Structures of the O-polysaccharides and classification of Proteus genomospecies 4, 5 and 6 into respective Proteus serogroups ppt
... Nucleus 4) -b-D-Quip3NAc-(1fi 4. 52 1 04. 3 4. 53 102 .5 4. 74 1 04. 0 5. 24 97.6 5. 21 98.1 3.27 73 .5 3.69 56 .6 3. 54 77.2 4. 36 49 .0 3 .53 72.9 4. 05 58.0 3. 54 74. 9 3.71 74. 1 4. 25 77 .5 3. 74 74. 1 3 .52 77 .5 3 .56 ... 100.0, 102 .5 and 1 05. 3 in P vulgaris O8), two OCH2-C groups at d 62.2 and 63.3 (d 62 .4 and 63 .4 in P vulgaris O8), two nitrogen-bearing carbons at d 50 . 4 and 55 .4 (d 50 . 6 and 55 .5 in P vulgaris O8), ... originated from the absence from the Qui3NAc H1 ⁄ GlcNAc H6a and H6b (d 4. 52 ⁄ 3.90 and 4. 17); GlcNAc H1 ⁄ GalA H4 (d 4. 53 ⁄ 3.80); GalA H1 ⁄ GalNAc H3 (d 4. 74 ⁄ 4. 25) ; GalNAc H1 ⁄ Qui3NAc H4...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo y học: "CTLA-4 +49A/G and CT60 gene polymorphisms in primary Sjögren syndrome" docx
... CTLA -4 +49 A /G* A allele excess among patients with pSS (A/A 48 %, A /G 26%, G/ G 26%, G/ A 0 .4% ; in comparison with A/A 45 %, A /G 21%, G/ G 34% among controls), leading to an excess of +49 A /G* A allele ... 1 .41 , 95% confidence interval (CI) 1.02 to 1. 95; Table 1) No significant difference in CTLA -4 +49 A /G* A allele frequencies was observed among subgroups of patients according to their anti-SSB and/ or ... of two haplotypes bearing the same allele (CTLA -4 +49 A /G* A), was actually more probably due to the statistical weight of the CTLA -4 +49 A /G* A allele than to a true functional effect of two different...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Divergent expression of claudin -1, -3, -4, -5 and -7 in developing human lung" potx
... GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG claudin CCGGCGACAACATCGTGAC CGGGTTGCTTGCAATGTGC claudin CGCGAGAAGAAGTACACGG CCTTAGACGTAGTCCTTGCGG claudin CGCATCAGGACTGGCTTTATCTC CAGCGCGATGCCCATTA Kaarteenaho et ... Claudin-3, -4 and -7, but not claudin-1 and -5, were positive in type II pneumocytes (Fig 3A- 3G, 4A- 4G) Claudin-1, -3, -4 and -7 were expressed strongly in bronchi and bronchioles (Fig 3G, 4C, 4D, 4G) ... localization of five different types of claudin, namely claudin -1, -3, -4, -5, and -7, in normal human developing lung at different gestational ages i.e from week 12 to week 40 during the pseudoglandular,...
Ngày tải lên: 12/08/2014, 11:22
family and friends lớp 4 unit2 lesson 5
... Reading New words top of neck Tongue leaves read silent Friday, October 10 , 20 14 Unit 2: Leson - Reading Write True (T) or False (F) The giraffe is tall T The giraffe has hasn't gotgot two hand hands ... giraffe is tall T The giraffe has hasn't gotgot two hand hands F The giraffe is black yellowand andwhite brown F The giraffe has got two ears T translate thank you! ... It’s orange What are they? They are parrots What are they? They are giraffes LUCKY NUMBER N1 th Friday, October 10 , 20 14 Unit 2: Leson - Reading repeat th Friday, October 10 , 20 14 Unit 2:...
Ngày tải lên: 20/12/2016, 09:51
gióa án family and friends lớp 4 từ unit 5 đến unit 8
... hands: box/fig, log/dog, bin/box, big/fig, fox/box, log/big, bin/tin Write the words that rhyme Work in pairs and compare the answers Fox/ box Bin/ tin Log/ dog Big Fig Act 4: sounds fun: Listen ... hands: box/fig, log/dog, bin/box, big/fig, fox/box, log/big, bin/tin Write the words that rhyme Work in pairs and compare the answers Fox/ box Bin/ tin Log/ dog Big Fig Act 4: sounds fun: Listen ... Help ss find diference betwween sounds /ɪ/ and /ɒ/ - Vocabulary: dog, fox, log - Addition: sitting II- Teaching aids - CD 51 -52 ; thẻ Phonics 13- 15 (dog, fox, log) thẻ Phonics 6, 7, 12, 15, 24 Lớp...
Ngày tải lên: 27/02/2017, 21:27
Summary Fish scale was decalcified and disaggregated and then collagen was prepared by limited pepsin digestion. The yields of collagens were very high on a dry weight basis; sardine 50.9%, red sea bream 37.5% and Japanese sea bass 41.0%, respectively. Th
... Histidine Arginine Total Sardine Red sea bream Japanese sea bass 86 47 24 41 71 111 340 1 15 18 13 11 22 12 25 52 87 46 26 39 72 109 340 116 19 12 10 22 13 23 55 85 48 25 42 75 108 341 1 14 18 12 10 ... 30 85 U mg)1 protein; Sigma, USA) at °C for 24 h The pepsin-solubilized collagen was centrifuged at 50 000 g for h and the supernatant dialyzed against 0.02 m Na2HPO4 (pH 7.2) for days, changing ... SDS-PAGE and sardine collagen showed two a chains; a1 and a2 (Fig 3) Similarly, red sea bream (Fig 4) and Japanese sea bass (Fig 5) collagens comprised two a chains Although a band corresponding...
Ngày tải lên: 12/03/2017, 07:45
4 19 great inventions (space and technology)
... December 17, 190 3, the Wright brothers flew the first ever manned aircraft Orville Wright was the pilot for the first flight, which lasted just twelve seconds The first powered flight took place ... Wilbur Wright flew for fifty-nine seconds at a speed of thirty-one miles per hour The U.S Army, seeing a future use of this new technology, asked the Wright brothers to build a flying machine ... the flow of electricity in electronic equipment One of the first uses of transistors was in hearing aids that were small enough to fit into the ear In 1 95 5 scientists at Bell Labs designed the first...
Ngày tải lên: 26/04/2017, 10:17
4 19 effects of technology (space and technology)
... ©Royalty-Free/Corbis, (Bkgd) ©Yang Liu/Corbis; Title Page: ©Courtesy of the Museum of the Moving Image, London/DK Images; ©Tibor Bognar/Corbis; Getty Images; Getty Images; ©Stevie Grand/Photo Researchers, ... things we need Technology affects all living things Sometimes technology’s effects are unplanned These effects can be harmful to living things Motor vehicle emissions, industrial wastes, and ... (Bkgd) Opener: (TR) ©Royalty-Free/Corbis, (Bkgd) ©Yang Liu/Corbis; Title Page: ©Courtesy of the Museum of the Moving Image, London/DK Images; ©Tibor Bognar/Corbis; Getty Images; Getty Images;...
Ngày tải lên: 26/04/2017, 11:32
4 19 technology in the world (space and technology)
... of a needle The Technology of Food X rays and Beyond Technology can help provide food We need a variety of foods in order to be healthy Modern technology helps us to plant, harvest, and grow food ... resulting variety of food provides a healthy diet for us However, the technology of food production has some bad side effects Some fertilizers and pesticides can harm the environment, animals, and ... as follows: Top (T), Center (C), Bottom (B), Left (L), Right (R), Background (Bkgd) Getty Images; (BR) Lester Lefkowitz/Corbis, (TR) ©Stockbyte; 11 (TR) Getty Images; 12 (BL) Goodshoot Scott Foresman/Dorling...
Ngày tải lên: 26/04/2017, 14:41
Chapter 4: Getting Images into and out of Photoshop
... the left column 193 14 327 258 -ch09.qxp 1 94 8/20/08 6 :50 PM Page 1 94 Part II: Easy Enhancements for Digital Images ߜ If color or pattern is uniform, clone near If, for example, you’re removing a ... rounding off corners ߜ Feather: Like choosing Select➪Modify➪Feather, increasing this value softens the edges of the selection by blurring Use Feather for an overall softening of the edges; use ... 327 258 -ch07.qxp 1 54 8/20/08 3:02 PM Page 1 54 Part II: Easy Enhancements for Digital Images sliders to minimize the fringe Be patient and careful — often there will be one precise pair of settings...
Ngày tải lên: 27/08/2012, 14:35
Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"
... Studies of available$ No of Cases No of Controls OR# 95% CI P* [1,20] [1,20] 57 7 200 49 5 49 5 1. 04 1. 15 0. 75- 1 .44 0.69-1.90 0.81 0.61 [1,13, 15- 17 ,19] [ 14, 18,20] 1229 6 65 10 84 682 1. 24 1. 24 1.06-1 . 45 0.96-1.60 ... ORs of the RANTES -28C /G polymorphism and asthma risk Comparison No of Cases No of Controls OR 95% CI CG vs CC 1833 1739 1. 25 1. 04- 1 .50 P* 0.60 GG vs CC 153 8 151 3 1.98 1. 24- 3.16 0.29 GG vs CG+CC ... allergic inflammation Immunol Today 19 94; 15: 127-33 23 Alam R, Stafford S, Forsythe P, et al Rantes is a chemotactic and activating factor for human eosinophils J Immunol 199 3; 150 : 344 2-8 24 Schall...
Ngày tải lên: 26/10/2012, 09:39
Ảnh hưởng của phong cách lãnh đạo đến động lực làm việc của lao động gián tiếp tại công ty TNHH Nhà Nước một thành viên Dệt 19 trên 5 Hà Nội
... tổng số lao động 9 65 người Trong đó, lao động nam 2 45 người tương ứng với 25, 39% lao động nữ 720 người chiếm 74, 61% Qua số liệu ta thấy: - Tổng số lao động qua năm công ty không ngừng tăng lên ... Xây dựng lịch giảng dạy + Lịch giảng dạy bao g m: ngày tháng năm giảng dạy, tên giáo viên phân công giảng dạy, nội dung giảng dạy, số tiết giảng dạy, lịch phân công dạy thực hành tay nghề Thêm ... 30 - 45 tuổi Nhân viên > 45 tuổi Tỉ lệ 47 33 14 (%) 100 70,2 29,8 10,6 12,7 11 17 23 ,4 36,2 17,1 20 05 SL Tỉ lệ 58 41 17 (%) 100 70,7 29,3 8,6 12 15 24 25, 8 41 ,4 12 2006 SL Tỉ lệ 2007 SL 74 50 24...
Ngày tải lên: 05/12/2012, 14:32
V.G.5.11.06. 2006.11_Wetlands Classification System_VN_FINAL
... quốc gia U Minh Thượng Cà Mau Cà Mau 44 72 37 24 37’ o 1 04 46’ 9o 15 104o 55 o Kiên Giang 21800 36’ o 1 05 05 Cực Bắc: o 57 40 ”61 Khu BTTN ĐNN Thạch Phú Bến Tre 45 10 106o32 58 ” Cực Nam: 9o50’ 05 106o32 56 ” ... 1 05 32’ 18o13’ 105o 55 16o32’-16o39’ 107o20’-107o37’ 16o28’ 107o 45 15o18’-15o30’ 108o23’-108o 35 15o41’ 108o32’ 14o11’27” o 108 52 ’08” 14o07’-14o10’ 109o09’-109o50’ A II 19 41 30 31 32 33 34 ... có nguy bị đe doạ 45 62 Láng Sen Long An 3877 758 8 10o 44 -10o48’ 105o 45 -105o48’ 10o37’-10o46’ Đất ngập nước quanh năm, rừng tràm, đồng cỏ ngập nước theo mùa G m có 13 loài động vật hoang dã ghi...
Ngày tải lên: 17/01/2013, 17:09
BAI 19 - DIA 5
... núi cao ngun Rừng có nhiều g q Đ Trung Quốc có số dân đơng giới Con người sinh sống từ xa xưa đồng châu thổ màu mỡ miền đơng tạo nên văn minh Trung Hoa tiếng Trung Quốc có số dân đơng giới, kinh ... Trung Hoa tiếng Sơng Trường Giang • Miền Tây Trung Quốc chủ yếu núi cao ngun, có khí hậu khắc nghiệt Cơng nghiệp sản xuất máy móc Khai thác mỏ Đất nước Trung Quốc tiếng ngành nào? Trung Quốc có ... có số dân đơng giới, kinh tế phát triển mạnh với nhiều ngành cơng nghiệp đại Trung Quốc có kinh tế phát triển mạnh với nhiều ngành cơng nghiệp đại Con người sinh sống từ xa xưa đồng châu thổ...
Ngày tải lên: 14/06/2013, 01:27
Unit 4 : Getting started - Líten and read
... did you begin studying English ? Why are you learning English ? Do you speak any other languages ? How did you learn English in your country ? How will you use English in the English future ? ... 10 What aspect of learning English you find most difficult ? 11 What are you going to learn ? 12 What are your hobbies ? 13 Look at this picture Describe it 14 Read this passage ... from ?” She asked me where I came from III/ Practice Examination in English as a foreign language Stage One : Oral examination What is your name ? Where you come from ? Where you live ? Do you...
Ngày tải lên: 27/06/2013, 11:45
UNIT 4 B 1-5
... many ? Có bao nhiêu? + Sử dụng số thứ tự từ -> 10 Lp (khi) Tầng (nhà, trường) I/ Vocabulary Grade -Lp (khi) Floor Tầng (nhà, trường) First: Second: Third: Fourth: Fifth: Số thứ tự th nht th hai ... the dialogue: Fill the missing word into the dialogue Thu : Hello! Which grade are you in? Phong : Im in grade Thu : And which class are you in? Phong : 6A What about you? Thu : Im in grade , ... dialogue: (B5- P48) Thu: Is your school big? Phong: No, Its Thu: How many floors.it have? Phong: It floors Thu: Which class you in? Phong: I in class 6A Thu: Where your classroom? Phong: Its...
Ngày tải lên: 09/07/2013, 01:26
giáo an tuần 19 lớp 5
... thức vào giải toán - Hớng dẫn đổi đơn vị đo độ dài - G i HS chữa bảng Bài 3: Củng cố cách tìm số trung bình cộng tính DT hình thang - Hớng dẫn làm -G i HS chữa bài, nhận xét, ghi điểm C) Củng cố ... 75 : = 750 0 (m2) Số ki- lô-gam thóc thu hoạch đợc là: 64, 5 x ( 750 0 : 100) = 48 37 ,5 (kg) Đáp số: 48 37 ,5 kg thóc + Bài 3:HS quan sát hình vẽ tình diện tích hai hình thang ABCD AMCD theo đọ dài cạnh ... Hoạt động dạy học Hoạt động dạy T G + Hoạt động 1: Cho HS làm vào bảng Bài 1: Củng cố công thức tính DT hình thang GV cho HS tự làm chữa sau nêu đặc điểm hình thang Bài : tiếp tục củng cố công thức...
Ngày tải lên: 14/09/2013, 04:10
GA tieng viet lop 4 tuan 1-5
... HĐ HĐ Ngheviết Khoảng 16’-18’ Hoạt động giáo viên (GV) - Kiểm tra HS GV cho HS viết từ ngữ sau: dở dang,vội vàng,đảm đang,nhan nhản,tang tảng sáng,hoang mang + GV nhận xét + cho điểm Nghe – viết ... dâng cao, mẹ bà g a chèo thuyền cứu người c/ Ý nghóa câu chuyện: Ca ngợi người có lòng nhân ái, sẵn sàng cứu giúp đồng loại Truyện khẳng đònh người có lòng nhân đèn đáp xứng đáng Truyện nhằm giải ... b/Cho HS đọc giải + giải nghóa từ: GV Khoảng - GV giải nghóa thêm: 8’-9’ • “Vàng nắng,trắng mưa” nghóa mây -1 HS đọc to,cả lớp lắng nghe màu vàng bào hiệu có nắng,mây màu trắng bào hiệu có mưa.Ý...
Ngày tải lên: 17/09/2013, 01:10