other property plant and equipment and intangible assets such as a business or subsidiary of the acquirer
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
... review of the medical record, as a summary of all staff accounts Although the nurses assigned both ratings after treatment, their judgment about pretreatment behavior was based on a summary of notes ... to psychotherapy that, in turn, may repair the mechanism of crises, thereby making medication unnecessary Some authors explain the limitations of pharmacotherapy by the nature of BPD and complex ... administered the various measures and then interviewed the staff Finally, they obtained the medication regimen of each subject for before and after admission Raters, subjects and clinical staff at all...
- 12
- 477
- 0
ACCOUNTING FOR PROPERTY, PLANT, AND EQUIPMENT ppt
... general applicability of this standard and all other Federal financial accounting standards please refer This is the original Standard file; please check for the most recent update in the FASAB Handbook ... the original date of the maintenance forecast and an explanation for any changes to the forecast, * prior year balance of the cumulative deferred maintenance amount, * the dollar amount of maintenance ... and measurable Measurable means that an item has a relevant attribute that can be This is the original Standard file; please check for the most recent update in the FASAB Handbook at www.fasab.gov/pdffiles/handbook_sffas_6.pdf...
- 107
- 403
- 0
Federal Accounting Standards Advisory Board (FASAB): ACCOUNTING FOR PROPERTY, PLANT, AND EQUIPMENT docx
... for each major class of PP&E: * the original date of the maintenance forecast and an explanation for any changes to the forecast, * prior year balance of the cumulative deferred maintenance amount, ... to as stewardship land and will not be reported on the balance sheet Examples of land not associated with other items of general PP&E include land used as forests and parks and land used for ... it shall be categorized as general PP&E Other land (e.g., land in the public domain and national park or national forest land) shall be excluded from general PP&E and referred to as 4stewardship...
- 107
- 375
- 0
slide property, plant and equipment ias 16
... the land use right and the building on the basis of the relative fair values of the two assets The land use right is accounted for as an operating lease and the building is accounted for as property, ... cost or effort on an ongoing basis, the parent accounts for the property as property, plant and equipment IAS 16 - Objective and Scope IAS 16 objective: standards for the recognition and ... financial year-end management’s assessments of the machine changed It now estimates the useful life of the machine as 25 years (measured from the date of acquisition) and its residual value as...
- 27
- 1,133
- 7
Financial accounting chapter 09 plant assets, natural resources, and intangible assets
... service to the company for a number of years Referred to as property, plant, and equipment; plant and equipment; and fixed assets 9-2 Plant Assets Plant assets are critical to a company’s success ... recognizes the decline in service potential of the asset in a rational and systematic manner 9-27 LO Revaluation of Plant Assets IFRS allows companies to revalue plant assets to fair value at the reporting ... disposal in the Other income and expense” section of the income statement 9-33 LO Explain how to account for the disposal of a plant asset Plant Asset Disposals Sale of Plant Assets Compare the...
- 53
- 522
- 0
A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc
... borderland between Klein Namaqualand, and Gordonia, Cape Colony, and what was at that time known as German South- West Africa Four of them appeared a few years back in The State an illustrated magazine ... sea, almost due east and west, as far as the eye could reach, and we were able to ride in the "aars" or narrow valleys between them and make good progress So far vegetation of a sort was still abundant, ... Then a vulture flapped lazily up in front of us, and another and another and a tiger- wolf (hyena) lurched its gorged and ungainly carcass down the farther slope The fire was alive, but those that...
- 160
- 619
- 1
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... Statistical analyses MedCalc™ v 9.6.2.0 (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are presented as absolute and relative ... Edita Lukić, Goran Madžarac and Alen Švigir for their help in the acquisition and arrangement of the data Page of Author Details 1Department of Intensive Care Medicine, University Hospital Centre ... shock); ii) acute coronary syndrome (myocardial infarction and unstable angina); and iii) all other admission diagnoses This division was made due to the fact that sepsis and acute coronary syndromes...
- 8
- 656
- 1
Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx
... standards, education and health conditions, and others As a result, the farmers are limited to receive enough clean water supply and sanitation facilities as a social beneficiary Furthermore, their ... in order to reduce ammonia losses and plant damage (Simon, 2002) There were some data of the chemical feces and urine composition of the human and animal in Vietnam (Table 3) as well as average ... concerning sanitation facilities and hygienic human waste treatment in the libraries or bookstores, even simple ones Otherwise, the ways for treating the excreta and urine as a source of mineral nutrient...
- 7
- 476
- 1
Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx
... conducted in the USA [28], Australia [21], England [27] and Scotland [22] had reported a trend towards an increased PA in individuals older than 60 years of age In fact, the increase in PA has been ... times more likely than men to report that walking was one of their LTPA The decreased prevalence of LTPA among women can be attributed to monitorization of daily transports [26] Gallant and Dorn ... out the acquisition of the data, analysis and interpretation of data She has been involved in revising it critically RJG participated in the design of the study and performed the statistical analysis...
- 11
- 912
- 0
Tài liệu Youth Safety on a Living Internet: Report of the Online Safety and Technology Working Group pptx
... funds for travel by members and speakers and funds for meeting accommodations and staff support An unfunded mandate creates obstacles that can easily distract from the great work that such mandates ... of data storage has drastically fallen over the years, the true cost of retaining data comes in the form of having to protect ever increasing amounts of end users’ private data from smarter and ... author and media professor at the University of Southern California, also cautioned us against sensationalist media coverage of digital teens He said that what he and his fellow researchers of...
- 148
- 435
- 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... kDa and > 200 kDa were visible, as well as a faint band at 37 kDa, suggesting the presence of dimers All of the bands stained positively for heme c (Fig 1B) but only the high molecular mass bands ... was determined with the Bicinchoninic Acid Protein Assay Kit (Pierce), using horse heart cytochrome c as standard (Sigma) The relative molecular mass of the ccNiR complex as purified was estimated ... decrease of the area of the first peak and an increase in the second one This supports the idea that the high molecular mass ccNiR aggregate slowly dissociates upon Zwittergent 3–10 treatment As ccNiR...
- 12
- 593
- 0
The Euro Imbalances and Financial Deregulation: A Post-Keynesian Interpretation of the European Debt Crisis pot
... revenue, as a share of its interest-bearing (total earning) assets ROA equals “rate of return over assets. ” “Concentration” refers to assets of three largest banks as a share of assets of all commercial ... decomposition, states that the ratio of earnings to equity equals the product of the ratio of earnings to assets and assets to equity That is, Earnings Earnings Assets =( )*( ) Equity Assets Equity Assets ... disequilibria and debt accumulation in the periphery This imbalance became unsustainable, and this unsustainability was a causal factor in the global financial crisis of 2007– 08 The paper also maintains...
- 37
- 442
- 0
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx
... Some of the iterative elements of systems biology (A) Science can be said to advance via an iterative interplay between the worlds of ideas and of experimental data The world of ideas includes theories, ... may one day dream of a system that will read the literature for us and produce and parameterize (with linkages, equations and parameters like rate constants) candidate models of chosen parts of ... Ultimately, as a rened and improved Data standards and integration The rst is the need to integrate SBML (and other [188]) biochemical models and model representations into postgenomic databases...
- 22
- 706
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result of oxidation Identification of the active isoform Because of disulfide scrambling ... minima and explore more possible peptide conformations In order to analyze the rigidity and/ or flexibility of the peptide and assess the conformational stability of its backbone, conformers corresponding ... Epitope localization with truncation analogues The HNE peptide was gradually truncated from the N- and the C-termini and the shortened analogues were assessed for binding of mAb BH216 (Fig 4) The five...
- 13
- 492
- 0
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx
... LC8–target complexes interact via their ligands (E) Such an interaction between two ligandbound LC8 complexes via antiparallel b-strands of the ligands has been observed hitherto only as a crystal ... [87] GKAP is an important scaffold molecule involved in the assembly of a multiprotein complex at excitatory synapses Only the DYNLL2 paralog was identified as an interactor of GKAP in vivo, and ... Such a monomer–dimer transition could have regulatory roles in the interaction network of LC8 Originally, LC8 was identified as a substrate of Pak1 and LC8 phosphorylation on Ser88 was implicated...
- 17
- 573
- 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... Oligonucleotides ARA28 ARA253 ARA358 ARA439 ARA440 ARA444 ARA451 ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG ... CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC ... CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCAC GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAG CGTGAATTCACCGAGCATGTCACCAAAGCC AATCAGAATGGGATCCGGTGA CGGCTGACATTCTGATTGACTTGGACGG CAATCAGAATGTCAGCCGGTGACACAGG...
- 14
- 594
- 0
Báo cáo khoa học: The propeptide of cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F ppt
... curves and F (in the subnanomolar range), and the residual activity of the peptidases was measured using a synthetic fluorogenic substrate This analysis revealed relatively weak inhibition of cathepsins ... practically incapable of inactivating mammalian cathepsins L, K and B and papain [27] In another study, the inhibitory potential of 23 overlapping synthetic peptides spanning the propeptide of ... renaturation and dialysis (lane 3) (B) MS analysis by MALDI-TOF MS Approximately nmol of the purified propeptide was precipitated with trichloroacetic acid and analyzed by MS The measured mass for...
- 11
- 385
- 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt
... a preparation of A fumigatus mRNA obtained as described [22] The primers used were: Nt-Aspf1 (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA ... standpoint The relevance of Aspf1 as a major allergen in hypersensivity to Aspergillus [11] was a good reason for the study of its allergenic features and the role of the deleted portion in the IgE antibody ... antigens Diagnosis Aspf1 D(7–22) vs Aspf 1a a-sarcin vs Aspf 1a a-sarcin D(7–22) vs Aspf 1a a-sarcin D(7–22) vs a- sarcina Asthma Cystic fibrosis ABPA 33 50 20 33 30 33 50 89 70 20 33 22 a Data calculated...
- 9
- 517
- 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... probe was labeled and purified as described above A kb human b-actin cDNA fragment was used as the control probe and labeled with Ready-To-GoTM DNA Labelling Bead (–dCTP) (Amersham Pharmacia Biotech.), ... Cloning and characterization of Na+ channel b1B (Eur J Biochem 270) 4763 reaction (RT-PCR) and RACE-PCR Marathon-ReadyTM human adrenal gland and fetal brain cDNA libraries were purchased from ... were washed in NaCl/Pi and the avidin–biotin complex (ABC; Vector Laboratories) was applied to the cells for 30 The presence of the primary antibody was detected after two incubations in 3¢-diaminobenzidine-HCl...
- 9
- 415
- 0
santiago as a hemmingway code hero in the old man and the sea
... far as the side of the boat The Old Man And The Sea portrays Hemingway Code Heros to their fullest potential As Heros they try their hardest to persevere under pressure and achieve the goal in ... offered each other the best of company While out at sea Santiago is constantlywishing the boy was there to talk to or to help with the mighty fish Santiago does not have relationships with any ... catching the fish He did not go running to tell the other fishermen of the town about it, he just went home and fell asleep Landing the fish did not matter to the old man only to get it as far...
- 2
- 919
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25