obtain the yaw pitch and roll angles from a direction cosine matrix
Transcultural Flow of Globalized TV Franchises Examining The X Factor and Vietnam Idol from a Discourse Analysis Perspective
... then The two programmes are expected to be exactly the same from the content to format and presentation However, to what extent are they, in fact, similar? Are there any adaptations of the shows ... in the English cases Without a separate voting phase, they are given in various forms with great emphasis being placed on maintaining the rapport with the contestants The acceptance can be announced ... in the latter case - Strength of comments in the Vietnamese auditions In both the ‘pass’ and ‘fail’ Vietnamese auditions, the comments appear to be balanced, moderate and constructive with many...
- 12
- 302
- 0
THE EFFECTS OF MEGAMERGERS ON EFFICIENCY AND PRICES: EVIDENCE FROM A BANK PROFIT FUNCTION docx
... the acquiring bank during the available years before the merger, 2) the acquired bank or banks during the available years before the merger, and 3) the consolidated bank during the available years ... variables are statistically significant in the AROAa equation, eliminating the significance of the STINCOME variable (which was the only significant variable in the equation in Table 3), and almost ... specification is repeated in the last two columns of Table 3, using the changes in the profitability ratios AROAa and AROEa as the dependent variables AS discussed above, the changes in these profitability...
- 66
- 470
- 1
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... PAF The antifungal potency of the recombinant proteins was assessed by exposing A niger to mature PAF (mPAF), PAFK 9A, PAFK3 5A, PAFK3 8A and PAFK9,35,3 8A and carrying out a subsequent determination...
- 16
- 408
- 0
Báo cáo hóa học: " Cellulose fibres, nanofibrils and microfibrils: The morphological sequence of MFC components from a plant physiology and fibre technology point of view" pptx
... 1b), including the primary wall (P) and several secondary wall layers (S1, S2 and S3) Each of these layers is Page of characterised by a specific arrangement of fibrils as has been detailed described ... mainly to the primary and S1 layers of the fibre wall, which are preserved during chemical pulping Contrary to the outer layers of the fibre wall (primary and S1 layers), the S2 layer is characterised ... fibril, the microfibril, the macrofibril and the lamellar membrane In the work of Maier [13], the term “elementary fibril” was reported to have a diameter of 3.5 nm and was applied following the...
- 7
- 569
- 0
Báo cáo y học: "Impact of attention-deficit/hyperactivity disorder on the patient and family: results from a European survey" ppsx
... Pfizer and Shire and has been a speaker for ADHI, Admirall-Prodesfarma, APNADAH, AstraZeneca, ASTTA, Bristol-Myers Squibb, Eli Lilly, Esteve, GlaxoSmithKline, Janssen, Novartis and Solvay Cesar Soutullo ... that the relationships between the child and parent, the child and their sibling(s) and the child and other children were similarly affected amongst medicated (73%, 67% and 57%, respectively) and ... Pharma, Vifor AG and Canton Bern Ulrich Preuss has been an advisory board memeber for Eli Lilly, Janssen-Cilag, Lundbeck and Canton Bern and has research contracts with Eli Lilly, AstraZeneca and...
- 15
- 368
- 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... one another, and must always remember that even the unwanted have worth (81) And our country must abandon all the habits of racism, because we cannot carry the message of freedom and the baggage ... 16 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A Apart from the formal salutation at the beginning and farewell at the end, the ... 81) And our country must abandon all the habits of racism, because we cannot carry the message of freedom and the baggage of bigotry at the same time (s 82) The use of must strongly attaches authority...
- 44
- 578
- 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
... detectable and the amount of PCNA not extractable by Triton buffer was high in the same cells These results clearly show that the PCNA staining is colocated with the BrdU staining and this again ... and chromatin-bound proteins were prepared after the indicated incubation conditions (for details see Materials and methods) and equal amounts were separated on an 8% SDS/polyacrylamide gel After ... reflects the chain elongation during 25 and can be calculated as about 0.5 lmỈmin)1 at either end of growing daughter strands This is a very common elongation rate for mammalian cells Note that up...
- 11
- 610
- 0
Off the Rim Basketball and Other Religions in a Carolina Childhood docx
... and I always saw the Series at the house of a friend who was a big Yankee fan and friends, at age eight, always being adversaries, I took the other side And if the Dodgers in the National League, ... Smith a math teacher back in Kansas From what I have written you might think that my father was also an athlete and a sports fan In fact, he wasn’t much of either, but he was a loyal Carolina alumnus, ... had a favorite NASCAR driver but also Yadkin 15 a favorite car—usually the car their favorite driver drove, which was also usually the car their daddy bought and they defended that car with all...
- 260
- 492
- 0
Reproductive intentions and choices among HIV-infected individuals in Cape Town, South Africa: Lessons for reproductive policy and service provision from a qualitative study ppt
... married I will have to have a baby because…only I and my boyfriend…are aware that I am HIVpositive and people will ask why am I not becoming pregnant in marriage - woman not on ART There are guys who ... FINDINGS Participant characteristics Average time since HIV diagnosis was 2.5 years for women (range weeks–8 years) and 2.8 years for men (range weeks–10 years) The average age of female (range 20–45 ... pregnancy and childbirth was a woman’s prerogative assist us [but] it is not only about and that if their partner wished to have children and they did not, the child, it also is about us— they...
- 6
- 553
- 0
ACCOUNTING FOR CHANGES IN BIODIVERSITY AND ECOSYSTEM SERVICES FROM A BUSINESS PERSPECTIVE potx
... impacted by a company’s activities makes the task of developing CSR standards fairly daunting (Bhimani and Soonawalla, 2005) Financial reporting has traditionally been the domain of national standard ... energy, water and materials, as well as the generation of waste and emissions, are directly related to many of the impacts organizations have on their environment and (2) materials purchase costs are ... ‘true’ and ‘fair’ information about the actual economic performance of the company Therefore, financial accounting and reporting are being dealt with in national laws and international accounting...
- 63
- 418
- 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc
... λ′′ , µ′ and µ′′ are real, scalar constants, with the understanding that primed quantities are related to the real part and double primed quantitites to the imaginary part of a complex parameter ... physical/geometrical and numerical parameters to which the model appeals The physical/geometrical parameters of the SM form none other than the set p, whereas the numerical parameters of the SM can ... 1992), has a corollary (Wirgin, 2004): when the values of all the parameters, except PK of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the...
- 26
- 467
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... by an Australian Postgraduate Award and a Social Sciences and Humanities Research Council of Canada Doctoral Fellowship 474 Delivering Health Education via the Web: Design and Formative Evaluation ... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student ... interactivity; and, availability of Australian and international sources Annotations were provided for each link to inform the student about the topics and contents of the site The Activity Centre was designed...
- 12
- 411
- 0
ENGLISH AND VIETNAMESE JOKES from a pragmatic perspective
... English and Vietnamese jokes can be analyzed by means of the same pragmatic mechanism, they are speech act theories and the theory of conversational maxims The analysis illustrates the following basic ... theoretical background for the study CHAPTER 2: ANALYSIS AND FINDINGS This chapter is aimed at discovering how English and Vietnamese jokes are analyzed pragmatically and what similarities and differences ... read a joke named A fly”, and then asks the students to act as the waiter and customer at a restaurant in England Students are required to talk with each other independently This provides a...
- 47
- 826
- 4
![cruising the mexican riviera and baja [electronic resource] a guide to the ships and the ports of call.](https://media.store123doc.com/images/document/14/y/pc/small_pcm1401351395.jpg)
cruising the mexican riviera and baja [electronic resource] a guide to the ships and the ports of call.
... have very narrow lowland areas The Gulf of California separates the peninsula from the Mexican mainland and was originally known as the Sea of Cortés Although Americans always refer to it as the ... main theater, as Carnival Paradise well as many colorful bars and lounges concentrated on the Promenade Deck The piano bar adjacent to the aft lounge is a beautiful spot to relax As far as other ... MAZATLAN N C A M E X I San Blas Tepic Aguacaliente Puerto Vallarta GUADALAJARA Manzanillo Parque Nacional Vulcan de Colima Ixtapa/ Zihuantanejo Gulf of Mexico MEXICO CITY ACAPULCO R VERACRUZ...
- 295
- 831
- 0
báo cáo hóa học: " The Dutch version of the knee injury and osteoarthritis outcome score: A validation study" pdf
... MR and JANV critically reviewed the manuscript All authors have read and approved the final manuscript 18 Acknowledgements 19 The authors thank S.M .A Bierma-Zeinstra, M Bierma, L Blokker and ... moderate OA group and the revision TKA group It was not assessed the patients with severe OA and patients with a TKA The construct validity was moderate for the patient groups with mild and moderate ... et al and Faucher et al who claimed that the subscales Pain and Physical function of the WOMAC loaded on the same factor [25-28] In the present study, the factor loading of the question S4 (can...
- 11
- 442
- 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
... in analyses and interpretation of data He drafted the manuscript AG has been involved in analyses and interpretation of data and statistical analysis She helped to draft the manuscript RC participated ... demonstrated that these dual vaccines induced therapeutically potent anti-Ab and anti-influenza antibodies Materials and methods Mice Female, 5-6 week-old C57Bl/6 mice were obtained from the Jackson ... immunohistochemistry as described previously [20] A digital camera (Olympus, Tokyo, Japan) was used to capture images of the plaques at an × magnification The binding of anti-Ab sera to the b-amyloid plaques was...
- 15
- 431
- 0
Báo cáo hóa học: " Research Article The Nonzero Solutions and Multiple Solutions for a Class of Bilinear Variational Inequalities Jianhua Huang" pptx
... Journal of Mathematical Analysis and Applications, vol 128, no 1, pp 138–155, 1987 [3] S S Zhang and S W Xiang, “On the existence and uniqueness of solutions for a class of variational inequalities ... of Mathematical Surveys and Monographs, American Mathematical Society, Providence, RI, USA, 1997 Jianhua Huang: Institute of Mathematics and Computer, Fuzhou University, Fuzhou 350002, Fujian, ... Inequality and Complementarity Problem Theory with Applications, Shanghai Scientific Technology and Literature Press, Shanghai, China, 1991 [2] M A Noor, “On a class of variational inequalities,” Journal...
- 9
- 235
- 0
Báo cáo y học: "The International Documentation and Evaluation System IDES: a single center observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity" pdf
... gait, walking and orthopaedic aids, pain and additional medication for operated joint Complications: systemic and local postoperative complications and their consequences Radiology: angles and radiolucent ... β-angle (lateral view: angle between the longitudinal axis of the tibia and the articulating surface of the tibial component) and γ-angle (lateral view: angle between a line drawn through the anterior ... anterior shield and the posterior edge of the talar component and a line drawn between the dorsal aspect of the talonavicular joint and the calcaneal tubercle) were measured (Attachments I, III,...
- 8
- 316
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008