negative does vout still track vin we observe that for a sufficiently low vin the collector current of q1 drops to zero and rl carries the entire i1 fig 13 1 d for lower values of vin q1 remains off and vout i1rl 260mv
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... hepatitis, alcoholic hepatitis and autoimmune hepatitis were all excluded Clinical data were obtained and recorded immediately after enrollment Body mass index (BMI) BMI was calculated as the individual's ... embedded in paraffin, and stained with hematoxylin-eosin-safran and Masson's trichrome Hepatic steatosis, stage of fibrosis and grade of disease activity were determined according to the Guidelines ... steatosis, so as to evaluate the predictors of clinical and pathological characteristics in these patients with steatosis and their diagnostic values in hepatic fibrosis Patients and methods Patients...
- 6
- 606
- 0
Why Copying LIS from a Developed Country Does Not Work for a Developing Country?
... Pharaohs to Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16 - 21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed Country Does ... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory in developed ... but there is little evidence that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed...
- 2
- 422
- 0
DOES AESTHETIC APPRECIATION OF LANDSCAPES NEED TO BE SCIENCE-BASED? docx
... is a formalist, then it does not matter how the landscape originated Find a vantage point where trees near and far, foreground and background, are pleasantly framed, and admire the vista The ... and Salim Kemal and Ivan Gaskell (eds), Landscape, Natural Beauty and the Arts (New York: Cambridge U.P., 19 93) 11 Hildegard Binder Johnson, "The Framed Landscape', Landscape, Vol 23, No (19 79), ... work and reside; our human landscape is where we have placed our culture There are hardly any unpossessed landscapes Landscape is personal and cultural history made visible But landscapes are...
- 13
- 411
- 0
PRODUCT DIFFERENTIATION: DOES IT PROVIDE COMPETITIVE ADVANTAGE FOR A PRINTING PAPER COMPANY? pot
... products in this study are typically standard paper grades such as standard newsprint, standard SC for rotogravure printing, standard LWC for offset printing as well as standard WFU and WFC The ... regardless of a manufacturer The prices of standard grades are transparent and easily available The end-use of a paper defines how much a buyer can pay for paper The printing method has a dominant ... image of brands as a basis for commanding a premium" Chamberlin (19 65) elaborated on the concept of product differentiation which was offered as the explanation of a downward-falling demand curve...
- 275
- 407
- 0
does mcmurphy transfer his individualistic spirit into that o
... order that Nurse Ratched has created and maintains While there is not supposed to be gambling on the ward, one of McMurphy's first goals is to get the other patients to play cards with him for ... unfeeling, and mechanized nature of the hospital; by revealing her womanhood, this facade is destroyed and the men realize her weakness Now, although she defeats McMurphy physically, he has actually ... McMurphy's change from a nuisance to a savior is how he and the Chief resist Nurse Ratched in the disturbed ward (a section of the hospital for those patients who are considered the most insane or dangerous)...
- 4
- 141
- 0
Inactivation of gram negative bacteria by low pressure RF remote plasma excited in n2 o2 mixture and SF6 gases
... density of O 338 12 13 14 atom Vacuum 2007;82:66- 71 doi: 10 .10 16/j vacuum.2007.04.0 31 Jones RN Microbial etiologies of hospitalacquired bacterial pneumonia and ventilatorassociated bacterial pneumonia ... minutes against E coli O157, K pneumonia, P mirabilis, and E sakazakii on the standard medium decreased, while O2 percentage was increased and only 2% O2 pressure was sufficient to completely deactivate ... General of AECS, the Head of the Physics Department, the Head of the Chemistry Department, and the Head of the Molecular Biology and Biotechnology Department for their support Conflict of interest:...
- 5
- 269
- 0
Báo cáo hóa học: " Research Article Localization Accuracy of Track-before-Detect Search Strategies for Distributed Sensor Networks" doc
... leading to (19 ) , for k ≥ 1, and similarly for var (d y (k)) These latter expressions for the variances of the ranges dx (k) and d y (k) are more amenable to numerical evaluation, and are used for ... terms of sensor and target variables We then compute the expected area of intersection, and the variance of this area, for sensors distributed randomly according to a fixed and known, but arbitrary, ... value of 3.5552 at y = On the other hand, the behavior of the variance of the area of uncertainty for this example, as displayed by the dashed line in Figure 8, is not so clearly anticipated In the...
- 15
- 250
- 0
Influence of temperature on expander stability and on the cycle life of negative plates docx
... life of negative plates as well as the nature of the phenomena leading to degradation of the structure of NAM as depending on the EV mode of battery operation and temperature Experimental 2 .1 Pastes ... spongy lead, small samples of the formed active mass were washed thoroughly with water and then with alcohol After that the samples were treated with ether and then air dried The samples were subjected ... at 40 8C The expander UP- 414 can also be added to this group When the battery is cycled at 60 8C and is of the VRLA type, the expanders containing lignin and its derivatives disintegrate as a...
- 10
- 435
- 0
Báo cáo khoa học: "Stage II/III rectal cancer with intermediate response to preoperative radiochemotherapy: Do we have indications for individual risk stratification?" pdf
... the statistical analyses HC contributed the radiation therapy data and reviewed the manuscript LC participated in assembling of the data and reviewed the manuscript BMG and HB reviewed the manuscript ... study design, assembled and analysed the data and drafted the manuscript HR carried out the pathological diagnostics of the rectal cancer specimens and reviewed the manuscript KJ carried out the ... intra- and extramural vascular and perineural invasion Nodal staging included histological evaluation of all detected lymph nodes and statement of lymph node ratio in all cases with regard to the...
- 11
- 334
- 0
Báo cáo y học: "Synovial histopathology of psoriatic arthritis, both oligo- and polyarticular, resembles spondyloarthropathy more than it does rheumatoid arthritis" pot
... systematic comparison of synovial osteoclasts and RANK/RANK ligand in PsA, SpA and RA remains to be conducted Taken together, these three issues indicate that the absence of histopathological differences ... oligoarticular and polyarticular PsA Values are expressed as mean ± standard deviation or as numbers CRP, C-reactive protein; DIP, distal interphalangeal joint; DMARD, disease-modifying antirheumatic ... histopathological synovial studies we considered PsA as part of the SpA concept and compared it as such with other inflammatory joint diseases Although some early data are available on PsA synovial...
- 12
- 308
- 0
báo cáo khoa học: "How can we improve guideline use? A conceptual framework of implementability" pps
... seeks to validate and extend elements in a framework [45] This means data are coded using elements in the draft framework, and data that cannot be coded are analyzed to assess if they represent a ... type diabetes mellitus and symptomatic atherosclerosis CMAJ 2004, 17 1 :11 89 -11 92 Latosinsky S, Fradette K, Lix L, Hildebrand K, Turner D: Canadian breast cancer guidelines: have they made a difference? ... University of Toronto, Toronto, Ontario, Canada 2Department of Oncology; Department of Clinical Epidemiology and Biostatistics, McMaster University, Hamilton, Ontario, Canada 3Department of Medicine; and...
- 11
- 345
- 0
báo cáo khoa học: " Can we prevent drug related deaths by training opioid users to recognise and manage overdoses?" doc
... sequence, alignment and drafted the manuscript DB participated in the sequence, alignment and performed the statistical analysis, VM participated in the statistical analysis and draft of the manuscript ... 65.7% of the cohort originally trained This group consisted of 35 males and 11 females and had a mean age of 35.0 years 13 (28.9%) of the group reported that they had ever had an opioid overdose ... and ED helped to draft the manuscript All authors read and approved the final manuscript http://www.harmreductionjournal.com/content/6 /1/ 26 22 23 24 25 References 10 11 12 13 14 15 16 17 18 19 ...
- 8
- 260
- 0
Báo cáo khoa học: "Increased susceptibility of Huh7 cells to HCV replication does not require mutations in RIG-I" doc
... (5’CCTGCGGGGAACGTAGCTAG-3’) and RIG-I 530(5’-AATGATATCGGTTGGGATAA-3’), RIG-I 4 21+ (5’CCATTGAAAGTTGGGATTTC-3’) and RIG-I 14 10(5’-TGGCATCCCCAACACCAACC-3’), RIG-I 4 21+ and RIG-I 2990-(5’-TCTTCTCCACTCAAAGTTAC-3’) ... oligo AACTAAAGGCGCGCCATGGATAGATCCGGAAAGCCTGAACTCAC (carrying the Asc1 restriction site) and anti-sense oligo AGTTATGGTTTAAACCTATTCC TTTGCCCTCGGACGAGTGCTGGG or anti-sense oligo AGTTATGGTTTAAACCTATTCCTTTGC ... (Sigma) and sequenced (ABI-prism) using the above mentioned oligos and oligos RIG-I 474- (5’-GTAATCTATACTCCTCCAAC-3’), RIG-I 13 3 1- (5’-AGATCAGAAACTTGGAGGAT-3’), RIG-I 22 81+ (5’-AGTGCAATCTTGTCATCCTT-3’),...
- 8
- 315
- 0
Báo cáo khoa học: "ntravenous nitroglycerin does not preserve gastric microcirculation during gastric tube reconstruction: a randomized controlled trial" pdf
... measurements, and participated in data interpretation DG participated in the study design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript References ... MB was the principal investigator JVB acted as study monitor, assisted in the data analysis and helped to draft the manuscript AJ performed data collection KT and HT performed surgery and measurements, ... induction of general anaesthesia, a mid-thoracic epidural catheter was placed (between Th6 and Th8) to provide peroperative and postoperative analgesia In all patients epidural blockade was started...
- 6
- 234
- 0
Báo cáo khoa học: "What does high NT-proBNP mean in septic shock patients? A part of the puzzle" pdf
... upregulation of cardiac brain natriuretic peptide at the transcriptional and translational levels by pro-inflammatory cytokines and by conditioned medium derived from mixed lymphocyte reactions via ... early marker of prognosis and cardiac dysfunction in septic shock patients Crit Care Med 2005, 33 :10 01- 1007 Tomaru Ki K, Arai M, Yokoyama T, Aihara Y, Sekiguchi Ki K, Tanaka T, Nagai R, Kurabayashi ... MAP kinase J Mol Cell Cardiol 2004, 36:505- 513 10 Jardin F, Brun-Ney D, Auvert B, Beauchet A, Bourdarias JP: Sepsis-related cardiogenic shock Crit Care Med 19 90, 18 : 10 55 -10 60 11 Poelaert J, Declerck...
- 2
- 339
- 0
Báo cáo y học: "Occupational affiliation does not influence practical skills in cardiopulmonary resuscitation for in-hospital healthcare professionals" doc
... the design and planning of the study and was involved in drafting the manuscript and the statistical analysis JH revised the study manuscript and made important additions AB performed the statistical ... assessed with Friedman’s test In the Cardiff protocol, in which the observed measure was in ordinal scale, Page of the data were analyzed according to ordinal invariant measures for individual and ... Despite the information and the training in reduced target volume, according to the new guideline, they may have been unable to adapt to a lower volume The data program used for evaluation has...
- 6
- 453
- 0
Numerical study of pile capacity considering installation and negative
... divided by 18 Chapter Literature Review the factor of safety The load (dead load plus drag load) at the NP must be smaller than the axial structural strength of the pile divided by the factor of ... 19 2 xii Figure 5 -17 (a) The evaluated OCR profile for the granular layer and (b) COV of evaluated OCR 19 2 Figure 5 -18 (a) The evaluated OCR profile for the clay layer and (b) ... neutral point Calculated maximum dragload at neutral point based on method Allowable axial load capacity of the pile Geotechnical axial load capacity of the pile Interface strength reduction factor...
- 293
- 600
- 0
CLASSIFICATION OF SOLUTIONS FOR A SYSTEM OF INTEGRAL 2 EQUATIONS WITH NEGATIVE EXPONENTS VIA THE METHOD OF 3 MOVING SPHERES
... takes the form u(x) = + |x − x|2 12 13 14 15 16 17 18 Note that we had already dropped the factor 1/ 8π in (1. 4) in the original statement in [Xu05, Theorem 1. 1] Almost simultaneously, Li studied ... Lemma 7, we deduce that λ(x) < ∞ for any point x ∈ Rn Then Lemma tells us that u is of the form 15 u(x) = a1 (b 21 + |x − x1 |2 ) 13 p 16 (4 .1) n for some a1 , d1 > and some point x1 ∈ R Similarly ... Li and Zhu, Zhang and Hao first introduced the integral form of the method of moving spheres in [ZhaHao08] to provide a new proof for [CheLiOu06, Theorem 1. 1] However, the approach in [ZhaHao08]...
- 15
- 243
- 0
In this paper, we investigate the relationship between migration and species distribution in multizone environment. We present a discrete model for migration of three competing species over three zones. We prove that the migration tactics of species leads
... dependency), SEQ (sequential failures) and SPARE gates We first present the gates added in the DFT framework and we introduce a Markov model of such a system We assume that the failure times and the ... Simulations of the time intervals are ran in parallel The ending states of each simulation are computed at the end of the simulation of the time intervals and they are compared to the initial state ... PAND gates are more complex to deal with than the other parts of a DFT Let us first consider a PAND gate of two inputs, A and B It is represented by vector (XA , XB , W1 ) Property The PAND gates...
- 8
- 292
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008