myc in oncogenesis and as a target for cancer therapies
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target ... Poon, A & Sawynok, J (1999) Antinociceptive and antiinflammatory properties of an adenosine kinase inhibitor and an adenosine deaminase inhibitor Eur J Pharmacol 384, 123–138 32 Pawelczyk, T., Sakowicz, ... translational regulation, rate of turnover, subcellular localization, or association with as yet undefined regulatory factors The most abundant nucleoside kinase in mammals, AK has emerged as a...
- 9
- 497
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 5428–5437 ... nuclear localization of viral nucleic acids in nondividing host cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes ... viral and cellular proliferation by mediating long terminal repeat activation, cell cycle arrest at the G2 phase and apoptosis It is also involved in nuclear localization [31,32] and regulation...
- 10
- 434
- 0
DATA MINING IN BANKING AND FINANCE: A NOTE FOR BANKERS pdf
... DATA MINING IN BANKING AND FINANCE: A NOTE FOR BANKERS Rajanish Dass Indian Institute of Management Ahmedabad rajanish@iimahd.ernet .in As knowledge is becoming more and more synonymous to wealth ... in actually better segmenting, targeting, acquiring, retaining and maintaining a profitable customer base Business Intelligence and data mining techniques can also help them in identifying various ... banking and finance by finding patterns, causalities, and correlations in business information and market prices that are not immediately apparent to managers because the volume data is too large...
- 15
- 556
- 0
HOW TO SUCCEED IN SCHOOL AND UNIVERSITY - A GUIDE FOR PARENTS AND STUDENTS pot
... Perhaps foreign language instruction in US and Australian schools was based on misinformation Chances are that it still is Unfortunately a lot of educational practices are based on myths and fads ... Wisconsin at Madison After National Service in the British Army where he was a marksman, and a stint as a pilot in the RAF, Michael was a professor and senior lecturer He taught and carried out ... suggestions that it would reject in a higher brainwave state such as the wide-awake Beta Brainwave entrainment allows us to enter Alpha and Theta relatively easily Brainwave entrainment makes the...
- 55
- 402
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... hematopoietic compartment using a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral ... viral infections [20] Cancer therapy is a principal goal of the current clinical research on hESCs Recently, regression of metastatic melanoma tumors was achieved by transplantation of adaptive ... cell anemia carrying the human mutant variant of the b-globin gene (bS) that is responsible for the disease Fibroblasts from a diseased animal were reprogrammed into iPSCs, and the sickle cell anemia...
- 12
- 550
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... glyoxalase enzymes was then evaluated in this parasite by initial rate analysis Using the methylglyoxal glutathione hemithioacetal as substrate, the kinetic parameters for L infantum glyoxalase ... 1,2-diaminobenzene and using 2,3-dimethylquinoxaline as internal standard [36] Methylglyoxal synthase activity was assayed by measuring methylglyoxal formation from DHAP The reaction occurred in ... I assays Glyoxalase II activity assay was performed using the commercially available SDL-GSH and SDL-TSH prepared from T(SH)2 and MG using yeast glyoxalase I, as previously described Concentrations...
- 11
- 515
- 0
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx
... tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni eht ... tcudeuqa cilahpecnesem deworran a evlovni sulahpecordyh latinegnoc fo sesac rehtO etar etauqeda na ta FSC brosbaer ot illiv dionhcara eht fo eruliaf ot eud yltnerappa giF si sulahpecordyh )latinegnoc( ... dr3 yregruS laminA llamS fo koobtxeT ).de( D rettalS :nI yregrus lainarcartnI SR yelgaB secnerefeR ]01[ smotpmys dna sngis lacinilc laminim yalpsid taht slamina eht ni ylekil erom eb yam emoctuo...
- 4
- 384
- 0
Báo cáo y học: "Targeting Toll-like receptor signaling in plasmacytoid dendritic cells and autoreactive B cells as a therapy for lupus" pps
... 34 Tan EM: Antinuclear antibodies: diagnostic markers for autoimmune diseases and probes for cell biology Adv Immunol 1989, 44:93-151 35 Casciola-Rosen LA, Anhalt G, Rosen A: Autoantigens targeted ... secretion may be important for downregulating the endotoxin-induced inflammatory cytokine storm that characterizes early stages of bacterial sepsis In addition, IL-10 may also finely modulate the activity ... Braun and coworkers [65] provided additional evidence that poly I:C can aggravate renal disease in B6lpr mice, simultaneously causing polyclonal B cell activation and autoantibody secretion In...
- 11
- 552
- 0
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
... India, for being so encouraging and for always believing in me To my parents -in- law, Capt Prafull Bhate and Dr Jyotsna Bhate and my brother and sister -in- law, Anmol and Rama Bhate: thank you for ... unconditionally welcoming me into your family and for always treating me like a daughter and a sister Lastly and most importantly, I want to acknowledge my mum Ranjana Bapat and my late father, Ajit Bapat ... tough times and the long distances Thanks for always being there for me and for being my number #1 fan v ABSTRACT Aditi Ajit Bapat INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION...
- 156
- 218
- 0
RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK IN PHU THO PROVINCE AS a BASIS FOR PLANNING AND CONSERVATION WORK
... BIGNONIACEAE Markhamia cauda-felina (Hance) Craib Fernandoa brilletii (P.Dop) Steenis BURSERACEAE Canarium tonkinensis L CAESALPINIACEAE Senna siamea Lam DIPTEROCARPACEAE Hopea chinensis (Merr.) Hand.-Mazz ... Representatives are often families of Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation ... rice-leaf weeds such as Thysanolaena maxima, Saccharum arundicaceum, Miscanthus nepalensis, Miscanthus japonica, Miscanthus japonica, Saccharum spontaneum, Sasa spp., Neyraudia reynaudiana, etc...
- 27
- 532
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... than in the first one, whereas the pleasantness of the heightened aroma sample increased in the second tasting session compared with the first one (interaction of age group and aroma and tasting, ... investigation, since there are ambiguous results and evidence for and against on that matter Acknowledgements The authors thank practical trainees Linda van Mierlo and Pascalle Weijzen from Wageningen...
- 10
- 599
- 1
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... glazing; forms; decorative designs; painting and coloring Textile materials; ancient cloth and basket work; feather work Methods of making casts and models; taking squeezes, rubbings, copies, and ... Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, ... user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original "Plain Vanilla ASCII" or other form Any alternate format must include the...
- 28
- 665
- 0
Tài liệu Preventing Fraud and Corruption in World Bank Projects: A Guide for Staff ppt
... departments and conducted Bank mission work in more than 30 countries in Latin America and the Caribbean, Europe and Central Asia, and East Asia and the Pacific Before joining the Bank, Mr Pino was an audit ... work in energy projects in Latin America, Asia, and Africa Before retiring in 1998, he served for nine years as the procurement adviser for the Bank’s Regional Office for Latin America and the Caribbean ... This Guide was prepared by a team consisting of Mario A Aguilar (Consultant, Procurement sections and case studies), Livio Pino (LCOAA, Financial Management sections and case studies), and Jit B...
- 61
- 410
- 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... (Fig 1), including several areas in lipid and in nucleic acid regions, and one area associated with proteins (amide II) Training set spectra were used for model building in LDA The model was tested ... Data analysis All spectra were treated with in- house software working in a MATLAB environment (MATLAB 6, Mathworks Inc., Natick, USA) Spectra were separated in a training set constituted of 48 samples...
- 6
- 555
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... respiratory cilia in the rabbit and pig [185]; and hydrogen cyanide, acrolein, and acetaldehyde inhibited ciliary beating in the clam [182] Using an in vitro infundibular bioassay, the individual ... These data indicate that factors that increase adhesion of the oocyte cumulus complex to the cilia can decrease pick-up rate and explain why both mainstream and sidestream smoke solutions decrease ... identified in this screen (Table 1) were previously thought to be safe and are included on the FEMA GRAS list (Flavor and Extract Manufacturers' Association – Generally Regarded As Safe) and the FDA EAFUS...
- 17
- 733
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... domains G and II and domains III, IV and V In the S aureus EF-G structure, this loop has a bent conformation, and packs against domain III and interacts with the linker between domains III and ... displayed as side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect the FA-binding pocket Mutation sites are ... is inserted in domain G, and exists only in release factor and EF-G As in other GTPases, domain G contains a conserved P-loop, which coordinates the a- phosphate and b-phosphate, and two so-called...
- 15
- 474
- 0
Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx
... Bradford (Bio-Rad protein assay) using bovine serum albumin as standard Determination of the peroxidase activity The peroxidase activity was measured in a solution containing 0.1% (w/v) 2,2¢-azino-bis-(3-ethylbenzthiazoline-6-sulfonic ... (Stratagene) The vector was packaged with the Gigapack II packaging extract (Stratagene) The library contained 0.8 · 106 independent plaques and was amplified once As template for PCR the cDNA was ... peroxidase activities the gel was reacted with diaminobenzidine and H2O2 As can be seen in Fig 5A, a major and a minor activity exist in the animal Only the major activity (band I) is present in...
- 10
- 389
- 1
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... Rac2 and S10 0A9 Assay of NADPH oxidase activity after oxidase activation The dormant NADPH oxidase of neutrophil membranes was activated by mixing neutrophil plasma membranes and the recombinant ... bicinchonic acid reagent (BCA) (Bio-Rad) using bovine serum albumin as standard Arachidonic acid was dissolved in ethanol and stored as a stock solution, at a concentration of 200 mM Protein fractionation ... has a blocked N-terminal amino acid, analysis of the protein was carried out by mass spectrometry The protein band corresponding to S10 0A9 in the gel, following SDS/PAGE, was excised, and washed...
- 10
- 396
- 0
báo cáo hóa học:" KSP inhibitor ARRY-520 as a substitute for Paclitaxel in Type I ovarian cancer cells" potx
... give various final concentrations as described in the results section Each experiment was done in triplicate Caspase-3/7, -8, and -9 activity assay Caspase activity was measured using Caspase-Glo™ ... 12, and 24 hours "0" designation represents non-treated controls (a) Activity of capase-3, -8, and -9 was measured using Caspase-Glo assay, and (b) effect on XIAP, Caspase-2, and Bid was determined ... malignancies [1] The standard of care for newly diagnosed EOC patients is surgical debulking and administration of a platinum and taxane -based chemotherapy regimen, usually carboplatin and paclitaxel,...
- 9
- 538
- 0
báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc
... peak areas of individual standards Using this quotient the amine concentrations were estimated with standard curves for each individual isocyanate-amines’ run in parallel Analytical standards for ... median diamine values (expressed as μg/g creatinine) with standard deviations for the patient samples detected with mass spectrometry (analysed against analytical standards for each individual ... validation and controls and materials) Data analysis The excretion of the isocyanate diamines was expressed as median values ± SD (standard deviation) of the respective amine, per g creatinine...
- 8
- 433
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25