mount the file system to an empty mount point directory a and change to that directory
Optimized use of the outrigger system to stiffen the coupled shear walls in tall buildings (p 9 27)
... Chan and Kuang’s method, a continuum approach is designated to analyze a pair of coupled shear walls, stiffened by an outrigger and an interior beam at an arbitrary location on the height A parametric ... differentiating Equations (1) and (2) and combining with Equations (3) and (6), q and y can be eliminated and then the governing equations for the axial forces in the walls can be given by Copyright ... are the lateral deflection, the laminar shear and the axial forces in the walls in the section above and below level hs, respectively and Ib, E, A are second moment of area of connecting beams,...
- 19
- 410
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... access to and degrade individual polymer chains First, the chains are degraded by both endochitinases, that attack the chitin chain randomly, and exochitinases, that attack the chitin chains from ... AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared expression vector (pET30 Xa LIC) provided by the ... protein referred to as LlCBP3 3A) ; and a family 20 N-acetylhexosaminidase (LnbA) The chiA and yucG genes are separated by 19 bp in an operon starting with a putative transcriptional regulator positioned...
- 14
- 683
- 0
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... not cause paramagnetic shifts or influence the transversal relaxation Conversely, two equivalents of the ion cause the shift and disappearance of several signals, without the concomitant appearance ... resonances were affected at higher ratios, and the chemical shift variation reached a plateau at an approximately : protein ⁄ Ca2+ ratio The effect, which only implies chemical shift changes, was, ... (left) and anomalous difference maps for Eu3+ contoured at 6.0r above mean level (right) The view of (C) is changed to allow appreciation of sites M4 and M5 Protein side chains (ball -and- stick...
- 12
- 704
- 0
Báo cáo khoa học: " An immunohistochemical study of chromogranin A and Sp-1 immunoreactive cells in the gastrointestinal tract of ovariectomized rats" pdf
... noituliD A ninargomorhc :AGC ,ninargomorhc 1-pS enivob :GCB ;stibbar ni desiar erew aresitna llA* ASU ,AC ,airetnipraC ,.proC OKAD ASU ,atosenniM ,retawllitS ,niroS aiD ecruoS sisylana lacitsitatS ... noitartsnomed lacimehcotsihonummI T aganawI ,N arahianaY ,F otaS ,H ikhO ,Y otomihsaH 01 892-782 ,25 ,9891 lotyC lotsiH hcrA saercnap enircodne eninac eht ni II ninargoterces dna ,B dna A ninargomorhc ... detacolla erew slaminA syad rof noitazitamilcca retfa desu erew )napaJ ,reviR selrahC ;tpiecer nopu dlo kw-6( tar elamef )DS( yelwaD-eugarpS ytnewT o slamina latnemirepxE sdohteM dna slairetaM noitarepo...
- 6
- 349
- 0
báo cáo khoa học: " The buccal minor salivary glands as starting point for a metastasizing adenocarcinoma – report of a case" pptx
... caudal to the mandible Examination of the patient did not reveal facial paralysis, paraesthesia and palpable regional lymphadenopathy Haematologic parameters were all within normal range For further ... neurofibroma, schwannoma, malignant peripheral nerve sheath tumour, hemangioma, angiosarcoma) and from salivary glands (pleomorphic adenoma, adenoid cystic carcinoma etc.) [9,10] In view of the fact that ... firm appearance and spread to adjacent structures, its intraoperatively obvious bony invasion and considering the patient's history (lack of appetite and weight loss), a malignancy was the most...
- 5
- 338
- 0
Tài liệu Database File System: An Alternative to Hierarchy Based File Systems docx
... Companion (CHI ’96); pages 410–411 1996 • Towards a Semantic-Aware File Store Z Xu and M Karlsson and C Tang and C Karamanolis Xu, Z., Karlsson, M., Tang, C., and Karamanolis, C Towards a Semantic-Aware ... are objects that also have a name and contain data This data can be anything and is only relevant for the application that uses this data; the file system does not impose what the data must look ... a hierarchy based filesystem actually is Hierarchy based filesystems are created by directories and files A directory is an object wich has a name and it can contain directories and files Files are...
- 92
- 543
- 0
dranove - code red; an economist explains how to revive the healthcare system without destroying it (2008)
... began a strong push 10 · CHAPTER ONE for national health coverage for all working Americans and their families The president of the AALL, Alexander Lambert, was a physician and was also chairman ... the AMA was just one factor that stood in the way of the AALL national health insurance proposal Most Americans AN ACCIDENTAL HEALTHCARE SYSTEM · 11 blamed Germany for starting World War I, and ... physician and medical administrator, Paul Budd Magnuson, to chair it and appoint its members A year later, the commission recommended scrapping the Truman-Ewing plan once and for all It instead called...
- 290
- 355
- 0
Toward an Interactive Method for DMEA-II and Application to the Spam-Email Detection System
... that SDR is correlated with FAR Thus, the higher rate of detecting spam an approach brings the higher probability to alarm a ham (non-spam mail) as spam it gets and vice versa An effective spam ... approaches There are also a number of factors to evaluate the efficiency of solutions Among them, the Spam Detection Rate (SDR) and the False Alarm Rate (FAR) seems to be most obvious criteria to ... Detection System, which relies on the well-known Spam-Assassin architecture SpamAssassin is a common antispam system that developed by the Apache Software Foundation It examines email and assign a score...
- 15
- 291
- 0
The Design and Implementation of a Log-Structured File System
... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system ... would mean that new data could be written at the full disk bandwidth and there is no cleaning overhead A write cost of 10 means that only one-tenth of the disk’s maximum bandwidth is actually used ... the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved...
- 15
- 1,434
- 0
Báo cáo y học: "Users' guides to the medical literature: how to use an article about mortality in a humanitarian emergency"
... searches Relief-Web (a media and NGO repository maintained by the Office for the Coordination of Humanitarian Affairs), the Uppsala Conflict Database Program (a database that contains information ... follow the recommendations of the Standardized Monitoring and Assessment of Relief and Transition (SMART) initiative and seek studies of high quality [3] You will ask a support team in the capital, ... representative of the at-risk populations In many conflicts, the areas affected by conflict are regional and may prove difficult to access If a survey targets an ethnic group, such as Karen and Karenni...
- 9
- 694
- 0
The grammar of words an introduction to linguistic morphology
... position and therefore has accusative case, the word form kota has to be used if the word has a singular meaning, and the form koty if it has a plural meaning That is, one of the accusative forms has ... the means for expanding the lexicon of a language: there are other ways of creating lexical units, and the set of complex words can be enlarged by other means than regular wordformation 1.5 The ... structure has two axes, a syntagmatic axis and a paradigmatic one Morphology also serves to get a better understanding of the nature of linguistic rules and the internal organization of the grammar of...
- 323
- 694
- 2
An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel
... notional and functional - and those we take a balanced, multidimensional approach to syllabus design In addition, due to the discussion 19 about good points and bad points of approaches to syllabus ... in perceiving a language, the students must always be aware of the accompanying situation It is clear that the uses to which a language may be put are many; we cannot teach all of the structures ... learners' needs, but also to the constraint of the educational institution or system, and the length and scope of program based on the syllabus Goals can the analyzed according to their orientation...
- 43
- 591
- 1
Navigating the Windows 2000 File System with “Windows Explorer” and “My Computer”
... display the contents of the Documents and Settings folder Within this folder, locate the Administrative and All User folder Reflection There are various ways to navigate and to locate files and ... (C:)” icon to display the contents of the C:\ drive Change the view to details again if it is necessary to see the file information Locate the “Documents and Settings” folder and double-click on ... icon located on the desktop This will display all of the drives located on the system Click on the folder view button located on the menu bar A drop-down menu displays the folder and file options...
- 3
- 436
- 0
Tài liệu Những loại thức ăn giúp cơ thể giải độc tố ppt
... nghệ giàu canxi kali, làm dịu đau đường tiêu h a, đau bụng khan đầy chướng bụng Trong ăn uống, pha trộn nghệ để làm tăng hương vị tác dụng rau trộn theo chế độ ăn giữ eo thon Thì bẹ Món rau bẹ chần ... 27% folat Liều lượng tốt: 2-3 phần/tuần Chế biến theo kiểu hấp cách thủy luộc với nước để giữ thêm nhiều vitamine chất khoáng Quả d a tây D a tây loại chống oxy h a (thông qua caroten d a) giúp ... lại 100kcal chất xơ làm tăng nhu động ruột Liều lượng tốt: 250 - 300g, 1-2 lần/tuần Đậu Hà Lan Một phần 200g đậu Hà Lan cung cấp 60kcal th a mãn 20% nhu cầu dinh dưỡng hàng ngày, 23% vitamine C...
- 3
- 340
- 0
an overview of the financial system
... bought and sold • Brokers and Dealers 2-5 Structure of Financial Markets III Exchanges • Trades conducted in central locations (e.g., Toronto Stock Exchange and New York Stock Exchange) Over -the- Counter ... Provincial and Municipal Government Bonds • Government Agency Securities • Consumer and Bank Commercial Loans 2- Financial Market Instruments V 2- Internationalization of Financial Markets International ... maturities greater than year – – – – Stocks Mortgages Corporate bonds Government of Canada bonds 2- Financial Market Instruments IV Additional Capital Market Instruments Include: • Canada Savings Bonds...
- 24
- 3,102
- 2
Tài liệu Advanced Linux Programming: 7-The /proc File System pdf
... when the mount was added See the man page for the mount command for an explanation of flags for the various file system types /proc/mounts, the last two elements are always and have no meaning ... Can close tray: Can open tray: Can lock tray: Can change speed: Can select disk: Can read multisession: Can read MCN: Reports media changed: Can play audio: 7.5.3 1 Mounts The /proc/mounts file ... on these addresses, the name of the file, and other information The maps table for each process displays the executable running in the process, any loaded shared libraries, and other files that...
- 20
- 428
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25