0

melikov a and kaczmarczyk j 2007 indoor air quality assessment by a breathing thermal manikin indoor air 17 1 50 59

Energy level alignment of semiconducting organic electronic devices

Energy level alignment of semiconducting organic electronic devices

Cao đẳng - Đại học

... injection, and other oxide and alkali halide compounds have also been tested as intermediate layer between the electrode and OSC to enhance charge injection [18 , 19 ] A thick encapsulation layer ... spin-coated and baked at 13 0ºC (hotplate, 15 min) in the glovebox The metal 38 cathode was evaporated at a base pressure < 10 –6 mbar to define 4.27-mm2 diodes through shadow mask, and capped with 13 0-nm-thick ... organic light-emitting devices Nature 440, p 908- 912 ( 2006) 25 Braun, S., W.R Salaneck, and M Fahlman, Energy level Alignment at Organic/Metal and Organic/Organic Interfaces Advanced Materials...
  • 107
  • 571
  • 0
Báo cáo y học:

Báo cáo y học: " The formation of cysteine-linked dimers of BST-2/tetherin is important for inhibition of HIV-1 virus release but not for sensitivity to Vpu" potx

Báo cáo khoa học

... Grant from the NIH Intramural AIDS Targeted Antiviral Program to K.S and by the Intramural Research Program of the NIH, NIAID References 10 11 12 13 14 15 16 17 18 Strebel K, Klimkait T, Martin ... primers 5' ATAAC TCGAG GTGGA ATTCA TGGCA TCTAC TTCGT ATGAC TATTGC and 3' AAGCT TGGTA CCTCA CTGCA GCAGA GCGCT GAGGC CCAGC AGCAC The resulting PCR product was cleaved with XhoI and KpnI and cloned into ... Spearman P: Viral protein U counteracts a human host cell restriction that inhibits HIV -1 particle production Proc Natl Acad Sci USA 2003, 10 0 :15 154 -15 159 Callahan MA, Handley MA, Lee YH, Talbot...
  • 16
  • 275
  • 0
Báo cáo y học:

Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc

Báo cáo khoa học

... 332: 11 71 - 11 79 22 Choudhary MI, Nawaz SA, Zaheer-ul-Haq , Lodhi MA, Ghayur MN, Jalil S, Naheed Riaz, Yousuf S, Malik , Abdul , Gilani AH, Atta-ur-Rahman : Withanolides, a new class of natural cholinesterase ... of Karachi, Karachi 75270, Pakistan and 2Department of Chemistry, Quaid-i-Azam University, Islamabad 45320, Pakistan Received: January 2 010 Accepted: 16 June 2 010 Published: 16 June 2 010 © 2 010 ... 87:439-448 17 Atta-ur-Rahman , Feroz F, Naeem I, Zaheer-ul-Haq , Nawaz SA, Khan Naeema, Khan MR, Choudhary MI: New pregnane-type steroidal alkaloids from Sarcococca saligna and their cholinesterase...
  • 26
  • 279
  • 0
Báo cáo y học:

Báo cáo y học: "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy"

Y học thưởng thức

... were F1: 5’ GGT TTA AAC TTT ATT CTG ACT GTT CCC, R1: 5’ ACA CAA TTT AGT AAT AGC CAA AGT CAA C, F2: 5’ GTT GTT GTG AAG TAG AAA CTG ATT TCT AA, and R2: 5’ CTG GGG AGT GGG CCA Genomic DNA was applied ... gastric atrophy (GA) of Gab1 and the combinations of PTPN 11 and Gab1 genotypes among seropositive healthy controls Genotype Gab1 G/G G /A A /A G /A+ A /A Total PTPN11b Gab1 G /A+ A /A G/G G /A+ A /A G /A+ A /A ... essential component for ERK activation [13 -17 ] The activated SHP-2 is associated with Gab1 to mediate EGF-stimulated ERK2 activation, and Gab1 is the SHP-2 activator for the ERK MAP kinase pathway...
  • 6
  • 541
  • 0
Báo cáo y học:

Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx

Báo cáo khoa học

... infection Crit Care 2007, 11 :R122 Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto H, Iino S, Taniguchi N, Maruyama I: The ... rodent macrophages Scand J Immunol 2005, 61: 19 32 Park JS, Gamboni-Robertson F, He Q, Svetkauskaite D, Kim JY, Strassheim D, Sohn JW, Yamada S, Maruyama I, Banerjee A, Ishizaka A, Abraham E: High ... Frazier A, Yang H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J, Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ: HMG -1 as a late mediator of endotoxin lethality in...
  • 10
  • 384
  • 0
Báo cáo y học:

Báo cáo y học: "Protein Never in Mitosis Gene A Interacting-1 regulates calpain activity and the degradation of cyclooxygenase-2 in endothelial cells" pot

Báo cáo khoa học

... Shaffer A, Talley JJ, Masferrer JL, Seibert K, Isakson PC: Pharmacological analysis of cyclooxygenase -1 in inflammation Proc Natl Acad Sci USA 19 98, 95 :13 313 -13 318 Futaki N, Takahashi S, Yokoyama ... 19 97, 12 1:695-704 Page of (page number not for citation purposes) Journal of Inflammation 2009, 6:20 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Swierkosz TA, Mitchell JA, Warner ... with Image J 1. 34 s (NIH) Prostaglandin E2 concentrations were estimated from a standard curve and calpain activity was indicated by the fluorescence increase per minute Data were analyzed by Student's...
  • 9
  • 457
  • 0
Báo cáo y học:

Báo cáo y học: " Therapeutic efficacy of alpha-1 antitrypsin augmentation therapy on the loss of lung tissue: an integrated analysis of 2 randomised clinical trials using computed " potx

Báo cáo khoa học

... = 39) AAT (n = 60) Placebo (n = 59) p value 11 4 ± 14 .7 59. 7 ± 16 .0 57.0 11 7 ± 16 .4 60 .1 ± 16 .3 65.0 94 ± 21. 8 50. 7 ± 19 .5 47.6 98 ± 23.2 52.2 ± 15 .2 50 .1 103 .1 ± 21. 8 56.3 ± 17 . 3 56 .1 104.7 ± ... disease exacerbations: a meta-analysis JAMA 19 95, 273:957-960 Stewart LA, Parmar MK: Meta-analysis of the literature or of individual patient data: is there a difference? Lancet 19 93, 3 41: 418 -422 ... Research 2 010 , 11 :13 6 http://respiratory-research.com/content /11 /1/ 136 randomised clinical trials of augmentation therapy with alpha -1 antitrypsin that are integrated in the manuscript, has received...
  • 8
  • 257
  • 0
Báo cáo y học:

Báo cáo y học: "Molecular control of HIV-1 postintegration latency: implications for the development of new therapeutic strategies" ppsx

Báo cáo khoa học

... NF-kappaB, and c- http://www.retrovirology.com/content/6 /1/ 111 11 3 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2 12 3 12 4 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 Jun to the long terminal repeat promoter J Virol ... Members LSD1 LSD1 JHDM/Jumonji JARID 1A/ RBP-2; JARID1B/PLU -1; JARID1C/SMCX; JARID1D/SMCY; JHDM 1a; JHDM1b; JHDM 2a; JHDM2b; JMJD 2A; JMJD2B; JMJD2C; JMJD2D; JMJD3 e DNMTs (DNA methyltransferases) Family ... http://www.retrovirology.com/content/6 /1/ 111 15 3 15 4 15 5 15 6 15 7 15 8 15 9 16 0 16 1 16 2 16 3 16 4 16 5 16 6 16 7 16 8 16 9 17 0 HIV -1 replication and proviral DNA (COSMIC trial) Aids 2002, 16 :14 79 -14 87 Lafeuillade A, Poggi C, Chadapaud S,...
  • 29
  • 322
  • 0
Báo cáo y học:

Báo cáo y học: " Changes in the accessibility of the HIV-1 Integrase C-terminus in the presence of cellular proteins" doc

Báo cáo khoa học

... (5’-PO4CGAAGCTTCTTCTCTGCGTCAAATTCTGGATTCTCAAAAAATGGAATGGCGTTCTAACGCTGGTGGTTCTTT-3’, BAD inderlined) and AS5 (5’-PO4GCTTAGAACCACCAGCGTTAGAAC-GCCATTCCATTTTTTGAGAATCCAGAATTTGA-CGCAGAGAAGAAGCAA) which was ligated with ... 5’GGATGAGGATGCTTCTTCTCTGC-GTCAAATTCTGGATTCTCAAAAAATGGAATGG-CGTTC TAACGCTGGTGGTTCTTAACACATGGAATTCTGCAACAAC 3’; EcoRI site in italics) and used in a PCR fusion with F1 fragment using oligonucleotides containing respectively ... integrase J Biol Chem 19 98, 273: 3507 8- 3508 7 Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV -1 integrase J Biol Chem 19 97, 272 :16 196 -16 205 Page 10 of 10 31 Michel...
  • 10
  • 321
  • 0
Báo cáo y học:

Báo cáo y học: "HIV-1 protease inhibitor mutations affect the development of HIV-1 resistance to the maturation inhibitor bevirimat" pps

Báo cáo khoa học

... AAG AAT TTT GGC TGA AGC AAT G-3’ ;18 66 -18 90), GagA364V (5’-GGC AAG AGT TTT GGT TGA AGC AAT G-3’ ;18 66 -18 90), GagS368N (5’-GGC TGA AGC AAT GAA CCA GGT AAC CA-3’ ;18 78 -19 03) or GagV37 0A (5’-GCA ATG AGC ... GAG AAA T-3’; 15 44 -15 71) , Sk39 (5’-TTT GGT CCT TGT CTT ATG TCC AGA ATG C-3’; 16 5 816 31) , NCrev -1 (5’- TGT GCC CTT CTT TGC CAC AAT-3’; 19 90 -19 70), 5’clea-4 (5’-ATA ATG ATG CAG AGA GG-3’; 19 15 -19 31) ... Orally Bioavailable HIV -1 Maturation Inhibitors 239th ACS National Meeting & Exposition, San Francisco, USA, March 2 010 , Abstract 13 71 Blair WS, Cao J, Fok-Seang J, Griffin P, Isaacson J, Jackson...
  • 12
  • 239
  • 0
Báo cáo y học:

Báo cáo y học: "The therapeutic potential of a venomous lizard: the use of glucagon-like peptide-1 analogues in the critically ill" pdf

Báo cáo khoa học

... Australia, Australia 500 0 4Discipline of Medicine, University of Adelaide, Royal Adelaide Hospital, Level Eleanor Harrald Building, North Terrace, Adelaide, South Australia, Australia 500 0 Page ... Terrace, Adelaide, South Australia, Australia 500 0 2Intensive Care Unit, Level 4, Emergency Services Building, Royal Adelaide Hospital, North Terrace, Adelaide, South Australia, Australia 500 0 3National ... Peptides 2005, 12 8: 11 7- 12 4 14 15 16 Nauck MA, Walberg J, Vethacke A, El-Ouaghlidi A, Senkal M, Holst JJ, Gallwitz B, Schmidt WE, Schmiegel W: Blood glucose control in healthy subject and patients receiving...
  • 3
  • 260
  • 0
RESEARCH ON THE FIRST ORDER GAMMA AUTOREGRESSIVE GAR(1) MODEL TO APPLY IN THE FIELD OF HYDROLOGY

RESEARCH ON THE FIRST ORDER GAMMA AUTOREGRESSIVE GAR(1) MODEL TO APPLY IN THE FIELD OF HYDROLOGY

Tổng hợp

... 778. 81 1074.54 559 .19 267.63 14 7.64 10 1.39 87 .16 12 1. 01 1 01. 73 74.84 93.60 94 .19 754.37 11 16 .12 659. 08 m3/s Historical Data GAR (1) -M 10 00 GAR (1) -F THOMAS-FIERING 500 Month 10 11 12 Figure 3 .1: Mean ... recently, as remarked by Hong Liangjie (2 012 ), the algorithm proposed by Marsaglia and Tsang (2000) is ease coding and having fastest speed and was installed in the GSL library and Matlab software "gamrnd" ... 16 .264 16 .15 2 0.693 17 . 389 17 . 265 0. 718 16 14 12 10 Eq (4.7) Generated Data Year 10 15 20 25 30 35 40 45 50 Figure 4 .1: Autore coeff and skew coeff Similarly, the author obtained the tables and...
  • 27
  • 410
  • 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Báo cáo khoa học

... MATa, ade2 1, his3 1, 15, leu2–3 ,11 2, ura3 1, can1 10 0, qcr10D2::LEU2 MATa, leu2–3 ,11 2, his3, rip1D::LEU2, qcr9D2::HIS3 MATa, ade2 1, his3 11 ,15 , leu2–3 ,11 2, ura3 1, can1 10 0, rip1D::LEU2 qcr10D1::HIS3 ... qcr9D2::HIS3 MATa, ade2 1, his3 11 ,15 , trp1 1, leu2–3 ,11 2, ura3 1, can1 10 0, rip1D::LEU2 MATa, ade2 1, his3 1, 15, leu2–3 ,11 2, trp1 1, ura3 1, Dbcs1::HIS3 DQCR10 DISP ⁄ DQCR9 DISP ⁄ DQCR10 DQCR9 ⁄ DQCR10 ... qcr10D1::HIS3 MATa, ade2 1, leu2–3 ,11 2, qcr9D2::HIS3, qcr10D2::LEU2 MATa, leu2–3 ,11 2, his3, qcr6D::LEU2, qcr9D2::HIS3 MATa, ade2 1, his3 11 ,15 , trp1 1, leu2–3 ,11 2, ura3 1, can1 10 0, rip1D::LEU2,...
  • 15
  • 639
  • 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

Báo cáo khoa học

... 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢ Phi-C and Phi-W were complementary to each other Phi-C was labeled ... strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA ... single-strand DNA (ssDNA) and assimilation of ssDNA into homologous super-coiled duplex DNA J Biol Chem 276, 419 06– 419 12 10 Nara T, Hamada F, Namekawa S & Sakaguchi K (20 01) Strand exchange reaction...
  • 10
  • 568
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Báo cáo khoa học

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... Function), Jlactate(aPK) ¼ e4. 71) (0.782/aPK))0. 817 * ln(aPK)) (Vapor Pressure Model), Jlactate ðaPK Þ ¼ 11 1 Ã 0:45 81= aPYK Ã À0: 817 (Modified Hoerl Model), Jlactate ðaPK Þ ¼ 1: 21 þ 11 1Ã aPK aPK À 73:6 Ã a2 ... 1 :17 8 Ã aPYK þ 0:276 Ã a2 À 0 :16 5 Ã a3 PK PK mial fit), Jacetate ðaPK Þ ¼ À0: 013 7 þ 1: 636 Ã aPK À 0:284 Ã a2 PK (Quadratic fit), Jacetate ðaPK Þ ¼ 1: 91 Ã 0:701aPYK Ã a1 :17 7 (Hoerl PK model), Jacetate...
  • 12
  • 616
  • 0
Tài liệu The Formation of Christendom, Volume VI pdf

Tài liệu The Formation of Christendom, Volume VI pdf

Khoa học xã hội

... have used, and required him to meet at Rome the accusation brought against him by John Talaia, a duly elected patriarch of Alexandria, just as St Julius, a hundred and forty years before, had ... went to Gaul, conquered Narbonne, Toulouse, and Bordeaux, and afterwards Barcelona His half-brother Wallia, after reducing the Alans and driving back the Sueves and Vandals, planted his seat in ... coast, and Dalmatia, and these lands he was able to protect from outward attack and inward disturbance He made Ravenna his seat of government He did not assume the title of king at Rome He maintained...
  • 168
  • 375
  • 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Báo cáo khoa học

... X 813 23 and U5 019 4 The catalytic Asp44 and His264 are indicated by asterisks to activate the material, as previously described [15 ] However, all attempts so far to associate this material have failed ... onto a Sepharose CL-4B column and chromatography was performed as described in Materials and methods Enzyme activity was analysed by the standard assay and the immunoreactivity was detected by ... 5¢-GGTCAC GACTGATGGGAAAC-3¢ and 5¢-CCATGAGCTCCTC CACTGGT-3¢ and the RT-PCR kit (PerkinElmer, Boston, MA, USA), except that Advantage polymerase (Clontech, Palo Alto, CA, USA) was used The amplified...
  • 6
  • 520
  • 0
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

Báo cáo khoa học

... San Francisco, CA Jones MC (2007) Therapies for diabetes: pramlintide and exenatide Am Fam Physician 75, 18 31 18 35 Supporting information The following supplementary material is available: Table ... is a proline (aggregation breaker) Several other parameters are calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation profile above the HST, the total area ... the authors of waltz FEBS Journal 278 (2 011 ) 2428–2435 ª 2 011 The Author Journal compilation ª 2 011 FEBS S J Hamodrakas Software for controlling formation of bacterial inclusion bodies estimated...
  • 8
  • 415
  • 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Báo cáo khoa học

... S.M., Nagahama, Y & Miller, W.L (19 93) Steroid 17 alpha-hydroxylase and 17 , 20-lyase activities of P450c17: contributions of serine106 and P 450 reductase Endocrinology 13 2, 2498– 2506 Yanagibashi, ... product was confirmed by cocrystallization with commercial steroid (data not shown) Assessment of the 16 -ene-synthase, 1 7a- hydroxylase and 17 , 20-lyase activities of human and porcine P450c17 In order ... observed at a cytb5/ P450c17 ratio of : (0.25 lg cytb5/0 .1 lg P450c17) while the optimal stimulation is observed at a ratio of 12 : (1 lg of cytb5/0 .1 lg of P450c17) Transfections and enzymatic assays...
  • 7
  • 612
  • 0
Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf

Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf

Báo cáo khoa học

... GCA AG-3¢ Reverse: 5¢-CCC ATA TGG TAC CCC TTA TCT CCT GCG-3¢ HpaI AgeI/KpnI Forward: 5¢-TAA AAC CGG TAC GT T AAC CGT CGG TAA ACC G-3¢ Reverse: 5¢-TCG TTA ATA CCG GCA CCG ACC ATC GCC A- 3¢ Forward: ... S.V., Mustayev, A. A & Modyanov, N.N (19 87) A nity modification of E1-form of Na+,K+-ATPase revealed Asp- 710 in the catalytic site FEBS Lett 217 , 11 1 11 6 34 Pedersen, P .A. , J rgensen, J. R & J rgensen, ... 5¢-CAG CGT ACC GGT TTT ATC AAA CGC CAC C-3¢ NheI EcoNI/AgeI Forward: 5¢-TAA AAC CGG TAC GT T AAC CGT CGG TAA ACC G-3¢ Reverse: 5¢-CTT GCG CCA GTA GAT GCG TCG CG-3¢ Forward: 5¢-CGC GAC GCA TCT ACT...
  • 8
  • 500
  • 0

Xem thêm