0

mechanisms and functional roles

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học

... dimers, with monomers A and B in dimer and C and D in dimer (Fig 8) The a-crystallin domain of each monomer is composed of nine b-strands (labeled b2–b10), with the b6 strand situated in a large ... formation depends upon contact of b-strand 10 from the C-terminal extensions of monomers A and D with b-strands and in the a-crystallin domain of monomers C and B, respectively (Fig 8) A more prominent ... parent monomer Monomers A (green) and B (yellow) form dimer 1, while monomers C (red) and D (blue) form dimer L5 ⁄ 7, the loop between b-strands and which contains b-strand 6; N term, amino terminus...
  • 15
  • 515
  • 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Báo cáo khoa học

... equimolar amounts of Akazara scallop TnC Lanes h and m, ATnI-52K; lanes i and n, ATnI-19K; lanes j and o, ATnI1)128; lanes k and p, ATnI130)252; lanes l and q, ATnI232)292; lane r, Akazara scallop ... pellets (P) and supernatants (S) were redissolved in equivalent volumes of M urea solution and then run on SDS ⁄ PAGE Lanes a and d, in the absence of both TnC and Ca2+; lanes b and e, in the ... 0.043 and 0.021 lmolÆmin)1Æmg myosin)1, respectively, at 15°C (Fig 6A,B) In the present study, we compared the functional roles of the N- and C-terminal regions of 4482 H Tanaka et al molluskan and...
  • 12
  • 514
  • 0
Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc

Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc

Báo cáo khoa học

... NaCl were performed between 10 and 150 mM ligand, and, after each titration step, the fluorescence was recorded All curves were integrated between 320 and 380 nm and the relative fluorescence intensity ... of pGP204 and pGP628 using the primers SH1 (5¢-AAACCGCGGCAATGAAAAAG TTATTAGTCAAGGAG) and SH3 (5¢-AAAGGATCC GGTCTGCTACTAACACTAGGATTCATC) The PCR fragments were cut with SacII and BamHI and cloned ... dye-binding assay with BSA as standard was performed using the GRAPHPAD PRISM software (GraphPad Software, Inc.) and a one-site binding model f ¼ [mKAc(ligand)]/[1 + KAc(ligand)], where m is the overall...
  • 8
  • 340
  • 0
Báo cáo y học:

Báo cáo y học: "Serum-dependent transcriptional networks identify distinct functional roles for H-Ras and N-Ras during initial stages of the cell cycle" doc

Báo cáo khoa học

... non-overlapping functional roles for H-Ras and N-Ras in mammalian fibroblast cells and are consistent with our previous observations on actively growing fibroblasts [35] that pointed to preferential functional ... Casp9 Figure caspase and activation in N-ras-/ -and H-ras-/-/N-ras-/- fibroblasts Increased Increased caspase and activation in N-ras-/ -and H-ras-/-/N-ras-/- fibroblasts Caspase and activities were ... experimental system to test whether N-Ras and H-Ras play specific -or redundant - functional roles during the initial stages of the cell cycle, and to analyze potential mechanisms involved Thus, microarraybased...
  • 24
  • 359
  • 0
báo cáo khoa học:

báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt

Báo cáo khoa học

... proteins and the positions of cysteine residues in region III and cysteine residues in region V are conserved Regions II and IV vary among the proteins Region II is comprised of between 114 and 174 ... contig #8, [GenBank: BQ805093], and one EST in contig #10, [GenBank: BQ806189] However, phred quality scores of 50, 42 and 42 for [GenBank: BQ805093] and 44, 42 and 42 for [GenBank: BQ806189] ... A sharonensis (1) and A tauschii (1), one was from the tetraploid T turgidum ssp dicoccoides, and one each was from the hexaploid T aestivum cvs Chinese Spring and Cheyenne and the synthetic...
  • 14
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: "Summary The claudin multigene family encodes tetraspan membrane proteins that are crucial structural and functional components of tight junctions, which have important roles in regulating para­ cellular" pdf

Báo cáo khoa học

... claudin localization and function Most cell types express multiple claudins, and the homo­ typic and heterotypic interactions of claudins from neigh­ boring cells allow strand pairing and account for ... features of claudins and some of the known interactions and modifications EL1 and EL2 denote the extracellular loops and 2, respectively The transmembrane domains to (TM1 to TM4) and the regions important ... the roles of proteins in TJ formation and function The large number of claudin proteins and the heterogeneity in their patterns of expres­ sion emphasize their crucial roles in the development and...
  • 7
  • 348
  • 0
Sirtuin2 in the CNS  expression, functional roles, action mechanism and mutation induced alteration of molecular  cell biological properties

Sirtuin2 in the CNS expression, functional roles, action mechanism and mutation induced alteration of molecular cell biological properties

Cao đẳng - Đại học

... expression patterns, functional roles and action mechanisms In addition, polymorphisms or mutations of Sirtuins are well documented, but the significance of these variations for health and diseases of ... axons and oligodendrocytes in CNS (or Schwann cells in PNS) These interactions between neurons and oligodendrocytes on one hand affect proper differentiation and myelination of oligodendrocytes, and ... oligodendrocytes and Schwann cells regulate axon caliber, axon domain organization and clustering of ion channels and cell adhesion molecules (Sanchez et al., 1996; Arroyo and Scherer, 2000; Peles and Salzer,...
  • 180
  • 378
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 3

Mechanisms and Mechanical Devices Sourcebook - Chapter 3

Cơ khí - Chế tạo máy

... APPLICATIONS Viscous liquid adhesives are used to glue fabrics and paper, apply paper labels, make cardboard and wooden boxes and shoes, and bind books Specially designed machines are required if ... 56 CUTTING MECHANISMS By pressing down on the foot pedal of this mechanism, the top knife and the clamp will be moved downward However, when the clamp presses on the material, both it and link ... would bend and jam Avoid these designs, if possible—Especially if automatic assembly methods will be employed A rotary screw-feed handles screws, headed pings, shouldered shafts, and similar...
  • 41
  • 567
  • 1
Mechanisms and Mechanical Devices Sourcebook - Chapter 4

Mechanisms and Mechanical Devices Sourcebook - Chapter 4

Cơ khí - Chế tạo máy

... 4, and T3/T4 = L3/L4 = 2/3, where T3 and T4 are the numbers of teeth on gears and T1 and T2 will denote the numbers of teeth on gears and 98 and S = ∆θ 3/θ30 Hence θ30(1 + S)L3 = 360º For S = and ... = r4 and r2 = r3, there is no “differential motion” and the output remains stationary Thus if one gear pair, say and 4, is made partly circular and partly noncircular, then where r2 = r3 and r1 ... intermittent mechanisms based on timing belts, pulleys, and linkages (see drawing) instead of the usual genevas or cams is capable of cyclic start -and- stop motions with smooth acceleration and deceleration...
  • 33
  • 507
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 5

Mechanisms and Mechanical Devices Sourcebook - Chapter 5

Cơ khí - Chế tạo máy

... Dynamic and static balancing is simplified when an expanding wheel is attached to a nonexpanding main wheel As a pulley, an expanding wheel can have a steel band fastened to only one section and ... 11:45 AM Page 134 TWELVE EXPANDING AND CONTRACTING DEVICES Parallel bars, telescoping slides, and other devices that can spark answers to many design problems Figs and Expanding grilles are often ... steel band, or rope around the drum is fastened to the driving and driven members; sprocket-wheels and chain can replace the drum and belt GEARS Fig Matching gear-segments Fig 10 Racks and coupled...
  • 46
  • 572
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 6

Mechanisms and Mechanical Devices Sourcebook - Chapter 6

Cơ khí - Chế tạo máy

... Bearing adjustment This screw arrangement is a handy way for providing bearing adjustment and overload protection Rapid and slow feed With left- and right-hand threads, slide motion with the nut locked ... bearings—such as the ball and roller bearings and of sliding bearings—which include sleeve and hydrostatic bearings Neither rolling nor sliding, flexures simply cross-suspend a part and flex to allow ... 0.4—A linear spring rate and high load resistance with small deflections For height to spring ratios between 0.8 and 1.0—An almost linear spring rate for fasteners and bearing and in stacks For rations...
  • 25
  • 380
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 7

Mechanisms and Mechanical Devices Sourcebook - Chapter 7

Cơ khí - Chế tạo máy

... 204 Fig Mechanisms for generating (A) modified cycloidal curves, and (B) basic cycloidal curves true cycloidal This is done by a second steel-band arrangement As carriage I moves, bands and cause ... equations of motion Fig A standard differential winch consists of two drums, D1 and D , and a cable or chain which is anchored on both ends and wound clockwise around one drum and counterclockwise around ... ROLLER CHAINS AND THEIR ADAPTATIONS Various roller, side-plate and pin configurations for power transmissions, conveying, and elevating STANDARD ROLLER CHAIN—FOR POWER TRANSMISSION AND CONVEYING...
  • 42
  • 493
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 8

Mechanisms and Mechanical Devices Sourcebook - Chapter 8

Cơ khí - Chế tạo máy

... power losses in the gears and bearings and from windage and churning of lubricant gear power: A gear’s load and speed capacity, determined by gear dimensions and type Helical and helical-type gears ... motor comparable in size and power to those used in standard reel-to-reel recorders, and a large bi-peripheral flywheel and sturdy capstan that reduces wow and flutter and drives the tape A patent ... manufacturing and alignment and (2) thermal and vibrational changes in the sizes and positions of the meshing components One of the benefits is a reduction of gear-toothcontact noise and vibration...
  • 52
  • 642
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 9

Mechanisms and Mechanical Devices Sourcebook - Chapter 9

Cơ khí - Chế tạo máy

... bi-directional slip and independent torque capacities for the two directions of rotation It requires two springs, one right-handed and one left-handed, for coupling the input, intermediate and output ... faster Edges of the clutch bands carry the entire load, and there is also a compound action of one band upon another As the torque builds up, each band pushes down on the band beneath it, so each ... requirements of MIL-E-5400, class and MILK-3926 specifications Applications were seen in counter and reset switches and controls for machines and machine tools, radar systems, and precision potentiometers...
  • 46
  • 410
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 10

Mechanisms and Mechanical Devices Sourcebook - Chapter 10

Cơ khí - Chế tạo máy

... clutch plates, gear fingers, and pinned members form the basis of these ingenious mechanisms Mechanical stops are often required in automatic machinery and servomechanisms to limit shaft rotation ... between the pin and the rotating finger must be shorter than the thread pitch so the pin can clear the finger on the first reverse-turn The rubber ring and grommet lessen the impact and provide a ... between the indicator and the actuating drive However, the force amplification between the indicator and the drive is rel- 349 Sclater Chapter 10 5/3/01 1:07 PM Page 350 Speed and Tension Control...
  • 29
  • 510
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 11

Mechanisms and Mechanical Devices Sourcebook - Chapter 11

Cơ khí - Chế tạo máy

... completely encased and cannot expand beyond its original diameter The standard pump is made of bronze and will handle volumes to 15 gpm The Squeegee develops a vacuum of 25 in of mercury and will work ... sucking and pushing actions and are not churned or foamed 370 PUMPING ACTION is produced by the meshing of the idler and rotor teeth in this rotary pump The idler is pinmounted to the head and the ... single-gland type Automatic wear control compensates for normal wear and maintains volumetric efficiency This pump will handle to 300 gph without churning or foaming It needs no lubrication and operates...
  • 35
  • 430
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 13

Mechanisms and Mechanical Devices Sourcebook - Chapter 13

Cơ khí - Chế tạo máy

... opposite sense to ψ14, ψ13 and ψ12 This establishes points A′2, A′3 and A′4, but here A′3 and A′4 coincide because of symmetry of A3 and A4 about A0B0 Draw lines A1A′2 and A1A′4, and the perpendicular ... a2/a1 and the initial position of the gear set, defined by the initial positions of θ1 and θ2, designated as θ10 and θ20, respectively Typical B-curve shapes (Fig 4) include ovals, cusps, and loops ... to maximize snap-action Over-centering toggle mechanisms, as shown in Fig 1, are widely used in mechanical and electrical switches, latch mechanisms and mechanical overload controls These toggles...
  • 33
  • 561
  • 1
Mechanisms and Mechanical Devices Sourcebook - Chapter 14

Mechanisms and Mechanical Devices Sourcebook - Chapter 14

Cơ khí - Chế tạo máy

... elements and icons, and 2D drafting and detailing capability, which support design collaboration and compatibility among CAD, CAM, and computer-aided engineering (CAE) applications Designers and engineers ... permit lettering, callouts, and the entry of notes and parts lists, and some even offer the capability for calculating such physical properties as volume, weight, and center of gravity if the ... datums, and section lines • Automated geometric dimensioning and tolerancing (GD&T) • Symbol creation, including those for weld and surface finish, with real-time edit or move capability and leaders...
  • 23
  • 493
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 15

Mechanisms and Mechanical Devices Sourcebook - Chapter 15

Cơ khí - Chế tạo máy

... revised and edited the Second Edition of Mechanisms and Mechanical Devices Sourcebook after the death of Mr Chironis The late Nicholas P Chironis developed the concept for Mechanisms and Mechanical ... engineer in the military/aerospace industry and a Boston engineering consulting firm before changing his career path to writing and editing on electronics and electromechanical subjects He was a ... and newspapers on various topics in engineering and industrial marketing Mr Sclater holds degrees from Brown University and Northeastern University, and he has completed graduate courses in industrial...
  • 4
  • 430
  • 0
Mechanisms and Mechanical Devices Sourcebook - Chapter 12

Mechanisms and Mechanical Devices Sourcebook - Chapter 12

Cơ khí - Chế tạo máy

... left-handed threads, • An eye on a shank with external righthanded threads, and • A flanged collar with left-handed external threads to mate with the shank of the firstmentioned eye, and right-handed ... connectors In step 5, the handle is pushed upward an additional 15º, locking the handle cam and the slide In step 6, the handle is rotated an additional 30º, forcing the box and the mating spring-loaded ... the handle and retention cams as the box is moved rearward and downward 409 Sclater Chapter 12 5/3/01 1:24 PM Page 410 Perpendicular-Force Latch (continued ) dle has been installed on the handle...
  • 24
  • 489
  • 0

Xem thêm