0

mechanism based modeling of estrogen receptor binding affinity a common reactivity pattern corepa implementation

Mechanism based modeling of ductile void growth failure in multilayer structures

Mechanism based modeling of ductile void growth failure in multilayer structures

Tổng hợp

... latter two failure modes are induced high triaxiality, which take place over a distance of several foil thickness ahead of the crack tip In the area of mechanism- based failure modeling of crack ... the interface Peak stress carrying capacity is attained when approximately half of the interfacial surface area becomes severely softened by void growth At the same time, a 45° shear band develops ... toughness and plastic dissipation has a much smaller influence as void size increases beyond 1% This is because the softening effects of a large void has already created a large degree of damage to...
  • 186
  • 225
  • 0
Differential global effects of selective estrogen receptor modulators on estrogen receptor binding and transcriptional regulation

Differential global effects of selective estrogen receptor modulators on estrogen receptor binding and transcriptional regulation

Cao đẳng - Đại học

... GGTCCtggTGTCC AGCCAagaTGACC GGTCAcggTGGCC AGTCAatcTAACC GGTCAaggCGATC GGACAaggTGTCC GGTCAtctTGATG AATCAgacTGACT GGACAagaTGACC GGACAgccTGGCC ttaGGTCAgctTGTCCcag ctgGGTCAgcaTGACCttc ctgGGGCAtgcTCACCtca cagAGTGAactTGACCtga ... GACCAgccTGACC Internal GGACAagcTGCCC Internal TGTCAagaAGACC Internal GATAAgtcTGACC Internal GGTCActcTGGCT Internal AGTCAaccTTACC Internal GCTCAacgCGACC Internal GATCAgaaGGACC Internal GCTCAcgaTGACG ... cagAGTGAactTGACCtga gagGGTCAtccCAACCcca ccaGGTCGgctTGCCCtta atgGGTCActgTGACCcag cccGGACAcgaTGTCCccc cacGGTCAtggTGACCtga ggaGGTCTaggTGACCtcg gggAGACAcccTGACCtaa aggGGTCAtggTGACAtta ctgGGTCActgTGTCCgga...
  • 214
  • 203
  • 0
Dynamics in Human and Primate Societies: Agent-Based Modeling of Social and Spatial Processes pdf

Dynamics in Human and Primate Societies: Agent-Based Modeling of Social and Spatial Processes pdf

Kỹ thuật lập trình

... Dynamics in Human and Primate Societies: Agent -Based Modeling of Social and Spatial Processes This page intentionally left blank DYNAMICS IN HUMAN AND PRIMATE SOCIETIES Agent -Based Modeling of ... toward the "lateral" attractors at the coordinate axes The trajectories that approach the saddle points at arbitrarily small distances are called separatrices because they divide the phase space ... represents a kind of circular causality and is the hallmark of self-organization Spatial heterogeneity can have a dramatic impact on these processes, as it dictates which units are to interact and which...
  • 413
  • 313
  • 1
Coffee consumption modifies risk of estrogen- receptor negative breast cancer pdf

Coffee consumption modifies risk of estrogen- receptor negative breast cancer pdf

Sức khỏe giới tính

... coffee (Coffea arabica and Coffea canephora): chemometric evaluation of phenolic and methylxanthine contents J Agric Food Chem 2009, 57:4224-4235 Tavani A, Pregnolato A, La Vecchia C, Favero A, ... work was supported by National Institutes of Health (RO1 CA58427); and the Märit and Hans Rausing’s Initiative against Breast Cancer J Li is a recipient of the A* STAR Graduate Scholarship KH was ... significantly associated with age at diagnosis [23], every model fitted in the case-only analysis was also adjusted for age at diagnosis in years (continuous) The validation analysis based on the MARIE...
  • 10
  • 320
  • 0
Rating Based Modeling of Credit Risk: Theory and Application of Migration Matrices doc

Rating Based Modeling of Credit Risk: Theory and Application of Migration Matrices doc

Ngân hàng - Tín dụng

... for measuring the appropriate capital of banks, although the way to measure, manage, and mitigate risks differs from bank to bank In 1996 an amendment was TABLE 3.1 Rationale for a New Accord and ... environment, evaluation of the company’s strategic and financial management, financial analysis, and a rating recommendation Once the rating is determined, the company is notified of the rating and the major ... significant reviews can be found in Zavgren (1985), Altman (1983), Jones (1987), Altman and Narayanan (1997), Altman and Saunders (1998), and Balcaena and Oogh (2006) The latter provide a detailed...
  • 256
  • 657
  • 0
Báo cáo y học:

Báo cáo y học: "Application of methods of identifying receptor binding models and analysis of parameters" potx

Báo cáo khoa học

... receptor binding models or to analyse the parameters by traditional analytical methods Materials and methods Let us write the law of mass action for each ligand -receptor interaction scheme as: For ... Scatchard G: The attraction of proteins for small molecules and ions Ann NY Acad Sci 1949, 51:660-665 Jose MV, Larralde C: Alternative interpretation of unusual Scatchard plots: contribution of ... are inapplicable for definition of the cooperative binding parameters and for analysis of non-equilibrium binding Regression methods can be found for the measurement of ligand -receptor interaction...
  • 4
  • 290
  • 0
Báo cáo y học:

Báo cáo y học: "Discovery of estrogen receptor α target genes and response elements in breast tumor cells" ppsx

Báo cáo khoa học

... (a) Genome Biology 2004, Volume 5, Issue 9, Article R66 Lin et al R66.13 GREB1 ERE 5′ -GAAAAAAAGTGTGGCAACTGGGTCATTCTGACCTAGAAGCAACCAAAATACTT-3′ 5′ -GAAAAAAAGTGTGGCAACTGGGTCATTCTGACCTAGAAGCAACCAAAATACTT-3′ ... CGACCCACAGAAATGAAAAGGCAGCAAACT ABCA3 ERE: forward, CACCTTCCATCTGTCCAAAG; reverse, CAACCCTGAGGTTTGGGAAC Actin exon control: forward, AGACCTTCAACACCCCAGCC; reverse, GTCACGCACGATTTCCCGCT Amplification ... -GAAAAAAAGTGTGGCAACTGGGTCATTCTGACCTAGAAGCAACCAAAATACTT-3′ 5′ -CAACAAAACTGTAGCAGCTGGGTCATCCTGACCTAGAACTGCCTGGAATGTTT-3′ 5′ -CAACAAAACCGTGGCCGATGGGTCATTCTGACCCAGAACTGCCTGGAATGCTT-3′ Human Chimpanzee Mouse Rat (b) −840 reviews Human Chimpanzee...
  • 18
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Explicit equilibrium modeling of transcription-factor binding and gene regulation" pdf

Báo cáo khoa học

... Fkh1p binding probability matrix Additional data file is a table of the Mcm1p binding probability matrix Additional data file is a table of the Sum1p binding probability matrix Additional data file ... information The following additional data are available with the online version of this paper Additional data file is a PDF file providing supplementary methods Additional data file is a table of ... Additional data file is a table of the Ndt80p binding probability matrix Additional data file is a table of the Rap1p binding probability matrix Additional data file is a table listing the CLB2...
  • 10
  • 281
  • 0
Econophysics and agent based modeling of financial market

Econophysics and agent based modeling of financial market

Cao đẳng - Đại học

... empirical data analysis Chapter describes a new agent -based model (ABM) of financial market, with some investigation on empirical behaviors based on market data Chapter extends the ABM to a stochastic ... one particular aspect of econophysics - agent -based modeling of financial market There are a number of universal patterns found in financial time series called ‘stylized facts’; among them are fat-tail ... Wharton School at University of Pennsylvania for academic research purposes It consolidates a broad range of financial databases including COMPUSTAT, CRSP, NYSE-TAQ and more [59] The range of data...
  • 162
  • 454
  • 0
Redox regulation of estrogen receptor alpha and sodium hydrogen exchanger 1 gene expression by hydrogen peroxide

Redox regulation of estrogen receptor alpha and sodium hydrogen exchanger 1 gene expression by hydrogen peroxide

Cao đẳng - Đại học

... decreasing the association of MKP-1 mRNA with translation repressor TIAR and TIA-1 Macrophage inflammatory protein- 1a (MIP- 1a) mRNA half-life was markedly increased after H2O2 treatment (Shi et al., ... used as an indicator of the oxidative damage to the cell 15 While moderately carbonylated proteins are degraded via the proteosomal pathway, heavily carbonylated proteins form aggregates that can ... instance, in the presence of ERα, typical agonists such as E2 and antagonist tamoxifen function as agonists in the AP1 pathway Raloxifene acts as a partial agonist In the presence of ERβ, tamoxifen...
  • 253
  • 317
  • 0
Dual activation of estrogen receptor a and aryl hydrocarbon receptor by the prenylflavone, icaritin restrict breast cancer cell growth and destabilize estrogen receptor a protein

Dual activation of estrogen receptor a and aryl hydrocarbon receptor by the prenylflavone, icaritin restrict breast cancer cell growth and destabilize estrogen receptor a protein

Tổng hợp

... availability of therapies targeting estrogen and growth factor signaling pathways, the incidence and mortality of breast cancers have not decline at the same rate as other major causes of death, ... northern America,   Australia and New Zealand, and in the southern countries of South America, especially Uruguay and Argentina (Bray et al, 2004) Incidences is low throughout Asia, Africa and most of ... microarray data analysis I am greatly appreciative of all the laboratory members (Vanessa, Faisal, Eileen, Dr Shijun, Gaik Hong and Seok Eng) who have generously extended their warm friendship and...
  • 134
  • 459
  • 0
Báo cáo y học:

Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

Báo cáo khoa học

... CAG CTG TGA CAC CTC AG-3'; CD32 forward 5'-TTC AAG GCC AAC AAC AAT GA-3', reverse 5'-GGA GAA GGT GGG ATC CAA AT-3'; CD64 forward 5'-GTG TCA TGC GTG GAA GGA TA-3', reverse 5'-GCA CTG GAG CTG GAA ... forward 5'-AGG CTG CTT TGG TTT GTG AC-3', reverse 5'-AGC AGG AGA AGC ACA TCA GC-3'; and IFI44 forward 5'-CTG GGG CTG AGT GAG AAA GA-3', reverse 5'-AGC GAT GGG GAA TCA ATG TA-3'; CXCL9 forward ... TTC TGA TTG GAG TG3', reverse 5'-TCA ATT TTC TCG CAG GAA GG-3'; CD14 forward 5'-ATT TGG TGG CAG GAG ATC AA-3', reverse 5'-GCT TCC AGG CTT CAC ACT TG-3'; CD16 forward 5'-ACA GGT GCC AGA CAA ACC...
  • 12
  • 200
  • 0
Báo cáo y học:

Báo cáo y học: "Mathematical modeling of the socalled Allis test: a field study in orthopedic confusion" docx

Báo cáo khoa học

... exists Without reliable and accurate ways of measuring leg length, it would be hard to argue that leg checking should be an important part of the manual therapist's physical examination protocol ... identify an anatomically short tibia Observed from the side of the table, a more cephalad knee is said to identify an anatomically short femur (See figure 1.) For the purpose of mathematical modeling ... dislocation or dysplasia) mutated into a test for LLI in adults, possibly of small magnitudes It appears that writers of orthopedic textbooks and their invited authors are making liberal use of each...
  • 7
  • 709
  • 0
Báo cáo y học:

Báo cáo y học: " Estimation and correction of non-specific binding in a large-scale spike-in experiment" pot

Báo cáo khoa học

... different aspects of normalization may or may not be separate in the actual software implementation of the algorithm, and their order of application is not necessarily identical for different algorithms ... calculated the area under the ROC (AUC) using Cyber-T P values as predictions To allow a comparison of AUC measures based on the presence or absence of transcript, we also made two AUC calculations ... information A detailed analysis of the present/absent calls indicates two failed labeling reactions, and almost 30% of the FC = and FC > probesets classified as having an absent target transcript...
  • 19
  • 274
  • 0
Modeling of precision motion control systems a relay feedback approach

Modeling of precision motion control systems a relay feedback approach

Cao đẳng - Đại học

... the advantages of relay feedback are totally lost Furthermore, the reliability of such approach is also a doubt, since the estimation of parameters using multi-parameter nonlinear optimization ... linear-nonlinear hybrid systems are mainly categorized into time domain based and frequency domain based approaches For the time domain approach, current existing methods based on relay-feedback ... covers a range of manufacturing processes that produce patterns or layers of material to form microstructures Lithography and MicroElectro-Mechanical-Systems (MEMS) are common examples of micro-fabrication...
  • 186
  • 265
  • 0
báo cáo khoa học:

báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

Báo cáo khoa học

... carcinoma cells Anticancer Drugs 2003, 14:193-202 103 Yagi Y, Fushida S, Harada S, Kinoshita J, Makino I, Oyama K, Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M, Hirakawa ... Clark A, Pradhan S, Jacobsen SE: UHRF1 plays a role in maintaining DNA methylation in mammalian cells Science 2007, 317:1760-1764 Sharif J, Muto M, Takebayashi S, Suetake I, Iwamatsu A, Endo TA, ... possibility that numerous other natural compounds can take the same pathways leading to apoptosis apoptosis in colorectal cancer by activation of p53 and p73 which are negative upstream regulators of UHRF1...
  • 10
  • 414
  • 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Báo cáo khoa học

... a model of the tRNA-assisted ATP–PPi exchange reaction and a model of the tRNA-assisted pyrophosphorolysis reaction of Arg-AMP at low pH Modeling of the ArgRS-catalyzed deacylation of ArgtRNA ... coordinated to Pb@O and ˚ Pc@O of ATP, with a distance of 2.1 A Figure 7A shows a model of Arg, ATP coordinated by Mg2+ and A7 6 of tRNAArg assisting the Arg-AMP formation reaction A model of NH2OH, ... CCA of tRNA to form aminoacyl-tRNA In the aminoacylation reaction of class I aaRSs with aminoacyl-AMP, the 2¢-OH group of the ribose of A7 6 tRNA attacks the carbonyl carbon atom of the –Ca–(CO)–O–...
  • 17
  • 512
  • 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

Báo cáo khoa học

... antagonist activity of BPA are observed for both (275Ala)-ERRc and (316Ala)-ERRc mutant receptors, and even for (Ala, Ala)-ERRc Discussion Differential capacity of Glu275 and Arg316 to interact with ... interactions Simultaneous mutation of these residues to Ala eliminated activity in binding to a BPA molecule, and individual mutations drastically reduced the activity Because Ala lacks the characteristic ... receptors Binding characteristics of [3H]BPA Position 275 Position 316 Dissociation constant (KD, nM) Receptor density (Bmax, nmol ⁄ mg) Glu Ala Asp Gln Leu Glu Glu Glu Ala Arg Ala Arg Arga Arg...
  • 12
  • 583
  • 0
Báo cáo khoa học: Dehydroepiandrosterone inhibits the proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism pptx

Báo cáo khoa học: Dehydroepiandrosterone inhibits the proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism pptx

Báo cáo khoa học

... et al DHEA and cervical cancer A TUNEL DAPI C3 3A Phase contrast Control Cisplatin DHEA B CASKI Control Cisplatin DHEA C HeLa Control Cisplatin DHEA 5602 Fig DHEA induces apoptotic death C3 3A (A) , ... than cisplatin was (Fig 6) On the other hand, CASKI and HeLa cells showed higher early and late apoptosis than C3 3A cells (Table 2) These results indicate that DHEA can induce early and late apoptosis ... can be converted to testosterone and then to estradiol by the P450 aromatase It has been shown that approximately 35% of cervical carcinomas express aromatase [37] and that DHEA binds to the androgen...
  • 12
  • 534
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Estrogen receptor independent neurotoxic mechanism of bisphenol A, an environmental estrogen" potx

Báo cáo khoa học

... nisnetoigna ni KTFAR/βKAC/2kyP esanik enisoryt evitisnes -muiclac fo eloR H arabustaM ,M adanI ,T akasawI ,Y akanaT ,Y ikasabihS ,Y ihcugiroM ,Y imustusT ,K amayuraM ,H ikasaM ,Y awazoN ,Y iroM ,S awasaruM ... inillobaraF ,A onizzumaracS ,I illeracceC ,C odneR ,D ateS alleD ,MA isiolA 96821-66821 ,69 ,9991 ASU icS dacA ltaN corP aimehcsi larberec lacof morf gnitluser egamad tsniaga stcetorp noitibihni esanik ... -Bκ-FN dna noitavitca Bκ-FN fo mrof eht ni rotaluger laropmet tnatropmi na sah )KRE( esanik detaluger-langis ralullecartxE ]9[ sllec lanoruen fo htaed dna lavivrus sa llew sa ,noitamrof etiruen...
  • 12
  • 247
  • 0

Xem thêm