... 1990s Paradigm 2: Marinefisheggsandlarvaearegenerallydesignedfordispersionandpotentialcolonization (panmixia) Reproduction in commercially exploited marine species generally involves ... in fisheries oceanography Spawning stock biomass (SSB) is a suitable proxy for the reproductive potential of a stock Marinefisheggsandlarvaearegenerallydesignedfordispersionandpotential ... major fisheries for small pelagic marine species, notes that only one stock (Icelandic summer spawning herring (Clupea harengus harengus)) had fully regained its original size and that the Icelandic...
... pseudo-random numbers on (0,1) for the probabilistic determination of a dephosphorylation event and the MWC algorithm for step direction determination Hardware We utilized a variety of platforms for ... root-mean-square effective distance for Erk1/2 and the average transport velocity for nerve growth factor [7] Such a comparison overlooks a critical feature of signaling endosome transport and a critical ... random walks modeled over one second of biological time incorporating both the diffusion coefficient criteria and the dephosphorylation probability criteria Again, the random walks are compared...
... ranking varies for different questions To better understand this interaction, we performed a series of Friedman tests for each question (the Friedman test is a standard nonparametric test for ranked ... there is no variance; the ranks 1-4 are fixed for each question 196 and have higher normalized Rouge scores, where the differences are larger for intersection than for union Inspection of the fused ... these questions, by collecting and comparing four different fusions for various pairs of related sentences, both generic and question-based ones, and both intersection and union ones While it seems...
... C Dyer, and F Och 2009 Efficient minimum error rate training and minimum Bayes-risk decoding for translation hypergraphs and lattices In Proc of ACL-IJCNLP R C Moore and C Quirk 2008 Random restarts ... optima and changing hyperparameters (e.g more random restarts in MERT) could improve system performance Table 1: Measured standard deviations of different automatic metrics due to test-set and optimizer ... is reported only for the tuning objective function BLEU Results are reported using BLEU (Papineni et al., 2002), M ETEOR5 (Banerjee and Lavie, 2005; Denkowski and Lavie, 2010), and TER (Snover...
... Viterbi alignments (GS-5 and GS-80) and a third was initialized naively9 (GS-N) Sampling settings were B = 400 for T↔E, 4000 for C↔E and 8000 for A↔E; M = 100, and L = 10 For reference, we also ... task8 for training, news2008 set for development, news2009 set for testing, and the 438M-word English and 81.7M-word Czech monolingual news corpora for additional language model (LM) training For ... 2001-2004) for training, the AFP portion of LDC2004T17 (news from 1998, single reference) for development and testing (about 875 sentences each), and the 298M-word English and 215M-word Arabic AFP and...
... Sumita and Tsutsumi, 1991; Kitamura and Yamamoto, 1996; Tanaka, 1997), with Sato (1992) and Sato and Kawase (1994) providing rare instances of character-based systems This is despite Fujii and Croft ... target are the vector space model (Manning and Sch¨tze, 1999, p300) and “token intersection” u For segment order-sensitive approaches, we test 3-operation edit distance and similarity, and also ... word-based indexing, and with each of unigrams, bigrams and mixed unigrams/bigrams The retrieval accuracies and times for the different string comparison methods are presented in Figs and 2, respectively...
... all noise and bustle, hurry and racket, roar and rush There is a fever in our blood We are restless and unsatisfied, ever and ever seeking for some new things We have lost the quiet, and the sheer ... than that of our poor forefathers No doubt, in comfort, convenience, interest, variety, general health and well-being, we are superior Are we, however, really happier than our forefathers? I doubt ... carts and carriages, and sailing ships There was no postal system, so letters were rare and costly luxuries; no telegraph, no telephone, no wireless or broadcasting Nearly all goods were hand-made,...
... method, accounting for multiple failures per patient andfor the calendar year The log-rank test was used to compare the different types of SpA and to compare the survival curves of SpA and RA Cox regression ... factors and discontinuation Besides estimation of drug survival and retention rate, the incidence rates of AEs were compared, and Cox regression analyses were used to detect and adjust for independent ... greater than 4, and additional clinical criteria For peripheral joint disease, TNF antagonists are recommended for patients who failed to respond to two NSAIDs and sulphasalazine and who have a...
... improved gas exchange and lung mechanics, promoted more uniform inflation, reduced air leak, and decreased the concentration of inflammatory mediators in the lung, compared with conventional ... clinical teams often are less experienced with HFOV This may place individual infants at greater risk for inadvertent overdistention of the lungs, for impaired cardiac output, or for increased central ... with low tidal volumes and reasonable ventilation goals In general, HFOV should be reserved for infants in whom CV is failing Pro’s response Sherry E Courtney, David J Durand and Jeanette M Asselin...
... a puff of odor Stereo olfactory cues are more important for humans and other animals with olfactory organs that are well separated in space [8,9] Humans, for example, can track odors based on ... manipulated flies and their larvae will no doubt contribute greatly to these efforts [10] As shown by Louis and colleagues [3], Drosophila, with its simple brain structure and wealth of genetic ... strategies with those of the larvaeAnd it will be especially interesting to explore the significance and neural basis of the transient, working memory processes apparently needed to mediate chemotaxis...
... savings And with ISOVER Gobain Gypsum, with the brands resistance – ensuring comfort and Gyproc, Placo and Rigips, manufac- safety for all • Contains 80 % recycled materials • Easy on- and off-site ... future radiates from a source into and ture of the building itself and there- sensitive ears will find the comfort Ն 68 (C50-3150) Comfort travels through the air, e.g fore called structure-borne sound ... of the comfort Take for example the wall use They offer, for example, building and thus reduces its hea- thickness Although the wall is thin- unmatched flexibility The room ting demand In brief:...
... our honeynet, and DNS cache hits from tracking 100 IRC servers for more than 45 days When insider information is not available because bot activities are not echoed on the channel (and so can no ... bots and joins a number of botnets, all the while recording any information observed on the command and control channel This information may include the identities of all active bots In this case, ... actual bots and temporary clones or migrants is nontrivial the discrepancy between the different size estimates, and (iii) we examine potential hidden structures among botnets we tracked and highlight...
... ONS and Bank of England for the UK and Federal Reserve and Flow of Funds for the US Figure 10: Core inflation Source: Eurostat (UK) and US Bureau of Labor Statistics (US) Note: Excludes food and ... demand sources, amplifying them, but not even a proximate cause in and of itself) These are in the Bank of England parlance rather chunky numbers, andare what we have to explain Reasons for ... policy and performance across countries is a rewarding pursuit intellectually, and sometimes in the form of policy relevant insights Tonight, I would like to directly compare policy and performance...
... [006] - Programas demo PLC S7-1200 da SIEMENS (Simatic) Filter criteria: Hardware platform : SIMATIC S7-1200, SINAUT Software : STEP Basic Entry contents : Application Examples Date:2011-12-30 Doc ... e_S7-1200_SMS_DOKU_V12_e.pdf Startup-Code (Project file for STEP V11) Containing also the outdated project file based on STEP V10.5 CE-X25_StartupProje ct.zip Additional information Title Link S7-1200 System manual ... communication solution with SMS Entry ID: 25545680 Latest modification Startup-Code and library with the actual version counter V1.2 and the append ant documentations is now adapted to STEP V11 Additional...
... about games and gaming If you thought that games arefor kids, that games are squandered time, or that games are dangerously isolating, addictive, unproductive, and escapist, you are in for a giant ... craft and refining their tactics for thirty years now And so it is that more and more people are being drawn to the power of computer and video games and finding themselves engaged by them for ... that we enjoy and choose for ourselves And when we hard work that we care about, we are priming our minds for happiness The right hard work takes different forms at different times for different...
... find out their ‘paradise’ For those who have been living in this city for a long time, more than 10 years for example, their ‘used-to-be paradise’ is getting worse and worse Sharing these ‘native’ ... serious the consequences of their frightening acts are It is impossible for anyone who dares to live in Ho Chi Minh City to get rid of the lack of safety and order resulting from the above- mentioned ... their life To tell the truth, I was born and grew up in Ho Chi Minh City and I am old enough to witness the tremendous, multifaceted changes and social reforms here However, I can hardly say that...
... performed using the forward and reverse primers CCTGTCTAGGCTGTCCCTAT and GCTTATGGAAGAGCTTGGAG for 30 cycles PCR products were cloned using the TOPO TA cloning system (Invitrogen, Paisley, UK) Forty-three ... flow cytometric and IL-1β secretion experiments, and wrote the first draft of the manuscript JHM designed allele-specific primers and typed the P2RX7 genes of NZB mice and NZW mice, and 16 17 Tsao ... proinflammatory and induces a form of cell death known as aponecrosis, which exhibits several characteristics of apoptosis We therefore suggest that the P2X7 receptor and gene have the functional and positional...
... of the cost and impact of the transport on the unit, the S and SB groups were combined and compared with the CarePorter group by Chi-square analysis Data are presented as mean and standard deviation ... with the CarePorter provided written informed consent All three groups, specialty bed (SB), standard (S), and CarePorter (CP), were subject to analysis of resource utilization, and time and motion ... power and gas for continuous treatment and monitoring of patients during transport The system was designed in an effort to decrease changes in patients’ level of care during transport and prevent...
... Critical Care Vol 10 No Moraes and Downey incidence of bacteraemia between the low and high apoptosis groups but they not discuss any other parameters ... the context of sepsis However, the study by Giamarellos-Bourboulis and coworkers is an important first step in trying to make sense of a complicated and fundamentally important process At the very ... multivariate model Competing interests The authors declare that they have no competing interests Page of (page number not for citation purposes) References Giamarellos-Bourboulis EJ, Routsi C, Plachouras...