m niv f g vlps morphologically biochemically and biologically mimic live niv
Báo cáo khoa học: "Development of a RVFV ELISA that can distinguish infected from vaccinated animals" pps
... pro- Methods Cloning of N and NSs genes PCR was used to amplify the open reading frame of N and NSs from the pCAGGS N and NSs vectors respectively [26] Primers used for N were as follows: RVFV ... XhoI 5' CGC TCG AGG GCT GCT GTC TTG TAA GCC 3' Primers used for NSs were as follows: RVFV NSs Hind III 5' CGA ACG TTG ATT ACT TTC CTG TGA TAT C 3' and RVFV NSs XhoI 5' cgc tcg aga tca acc tca aca ... AccuPrime Buffer I (Invitrogen), 10 ng plasmid template, 200 nM of each primer, and ul of AccuPrime Taq DNA Polymerase (Invitrogen) The following parameters were used for PCR: 94°C for min, then...
- 11
- 279
- 0
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf
... 7.0, mM EDTA, mM MgCl2, 20 mM NaCl, mM GSSG, mM GSH) and catalyzed by different concentrations of PDI In the refolding reaction mixture, the final concentration of reduced lysozyme was 10 lM The ... was monitored b Refolding of the reduced RNase A (final concentration 8.4 lM) was carried out in the refolding buffer (0.1 M Tris ⁄ Cl, pH 8.0, 0.2 mM GSSG, mM GSH, mM EDTA, 4.5 mM cCMP) and catalyzed ... of the refolding mixture of reduced Tx3.1 The refolding was carried out in the refolding buffer (50 mM NH4CO3, pH 8.0, mM GSH, 0.5 mM GSSG) for h nTx3.1 and sx3.1 are designated as N and S, respectively...
- 10
- 405
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... oligonucleotides specific for the region encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction ... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... Reagents All chemicals were of analytical grade and purchased from Sigma (St Louis, MO) Restriction enzymes, Taq DNA polymerase, T4 ligase and buffers for cloning were purchased from New England Biolabs,...
- 9
- 485
- 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf
... modified method of Tangpakdee et al [16] The reaction mixture contained, in a final volume of 0.2 mL, 50 mM Tris/HCl buffer (pH 7.4), 30 mM KCl, mM MgCl2, lM ZnCl2, mM dithiothreitol, 20 mM KF, 0.1 mM ... BL21(DE3), and mL of an overnight culture of the transformant in Luria–Bertani medium containing 50 lgÆmL)1 ampicillin was inoculated into 200 mL of M9 YG medium [29] containing 50 lgÆmL)1 ampicillin ... highly conserved regions among cis-prenyl chain elongating enzymes; sense primer, P1 (AFIMDGN, region I) 5¢-GCTTTTATTATGGAYG GHAA-3¢ and antisense primer, P2 (IRTSGE, region V) 5¢-CTCACCAGAWGTWCKWAT-3¢,...
- 10
- 516
- 0
Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebrafish SULT1 sulfotransferases docx
... Sequence Primer ZF SULT1 ST1 Sense Antisense 5¢-CGCGGATCCATGGACATGCCTGACTTTTCT-3¢ 5¢-CGCGGATCCTTAAATCTCAGTGCGGAACTT-3¢ ZF SULT ST2 Sense Antisense 5¢-CGCGGATCCATGAAACTGGATAGCCGGCCT-3¢ 5¢-CGCGGATCCTCATCTTTTGTTTGTAGTCCT-3¢ ... sulfate-free (prepared by omitting streptomycin sulfate and replacing magnesium sulfate with magnesium chloride) minimum essential medium for h, were labeled with 0.2 mL aliquots of the same medium ... Leibivitz’s L-15 medium, Dulbecco’s modified Eagle’s medium, minimum essential medium, and fetal bovine serum were from Life Technologies Trout serum was from East Coast Biologics, Inc Zebrafish liver cells...
- 8
- 537
- 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx
... CGTGCTCGTAAACGATGCGTATTAC ACAATCTCTTTGCCGGCCTCCGC GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen Biotechnology Co., ... range 1.0–27 mm l-glutamate with a fixed concentration of mm oxaloaceLÀglu ) and in the range 0.5–20 mm oxaloacetate tate (for Km with a fixed concentration of 12 mm l-glutamate OAA (for Km ) Km and ... primers are underlined Name Sequence of primers (5¢- to 3¢) P1 P2 D232N -F D232N-R K270H -F K270H-R R403Y -F R403Y-R GGTACCATGAATGATGCAGCAAAAG (KpnI) GAATTCTCAGCCTGATATTTCCGCCT (EcoRI) CGTGCTCGTAAACGATGCGTATTAC...
- 13
- 490
- 0
Báo cáo Y học: Trehalose-phosphate synthase of Mycobacterium tuberculosis Cloning, expression and properties of the recombinant enzyme pdf
... amplified from M tuberculosis H37Rv genomic DNA using the oligonucleotide primers DC 154 (5¢-ACTCGAGAGCATATGGCTCC CTCG-3¢) and DC 155 (5¢-AGCGGGATCCGCTT GACCGTTAGC-3¢) DC 154, the upstream primer, ... OtsA predicted amino acid sequence with those of homologous ORFs from M avium (Ma), M smegmatis (Ms) and E coli (Ec) The M avium and M smegmatis homologs were identified by searching the respective ... were obtained from the Institute for Genetic Research (TIGR) through the website at http://www.tigr.org Genome sequencing of M avium and M smegmatis was accomplished with support from NIAID This...
- 10
- 428
- 0
Báo cáo khoa học: Trehalose synthase of Mycobacterium smegmatis Purification, cloning, expression, and properties of the enzyme ppt
... The data from these peptides (Fig 2) was used to locate the ORF coding for TreS in the M smegmatis genome Cloning and sequencing of M smegmatis TreS cDNA 10 Fig Purification of M smegmatis TreS ... trehalose and maltose (Eur J Biochem 271) 4263 This ORF was amplified by PCR using the oligonucleotide primers TSFP 5¢-CACCATGGAGGAGC ACACGCAGGGCAGC-3¢ (4 158 182–4 158 159) and TSRP 5¢-CGACACTCATTGCTGCGCTCCCGGTTC-3¢ ... nickel column The TIGR unfinished M smegmatis genome sequence was screened using the TBLASTN program for DNA sequences corresponding to the amino acid sequences obtained from purified M smegmatis TreS...
- 11
- 459
- 0
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx
... proteins: four of 13 family-74 genes code for a family-2 CBM; three have a family-1 fungal CBM; one has a family-3 CBM; and five have no CBM The low Km of T fusca Xeg74 shows that the binding of the ... mg of GBG or 50 mg of GBX were weighed into 0.5-mL screw-cap microfuge tubes Buffer (0.05 -M NaKPi, pH 7.4) and enzymes were added to achive a final volume of 0.5 mL and the microfuge tubes were ... Xeg74 enzyme alone (0.05 nmol, 4.7 lg) produced 58 lg of reducing sugar from GBX and 6.9 lg from GBG The cel mix alone was not able to degrade GBX to any appreciable extent; however, when Xeg74...
- 9
- 453
- 0
Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf
... CCTGTCCGTGTCAAGCGCGTCTTGCCGCTGGT .CATCAGGACTGTGATTGCA 411 Cc-CATH2 C TC -C G G G- TTGGCC GC-T-C 397 Cc-CATH3 -G T -G -GCCGGTGGC -AC G -GC -G 420 Cc-CATH1 GGATACAACCTCTACCGGGCAATCAAGAGGAAGTGAgccgtccccagagctgctgtcacc ... The Authors Journal compilation ª 2011 FEBS F Feng et al Characterization of cathelicidins from C coturnix Cc-CATH1 ATGCTGAGCTGCTGGGTGCTGGTGCTGGCGCTGCTGGGGGGGGCCTGTGCCCTCCCGGCC 60 Cc-CATH2 ... (aataaa) is underlined Gaps are inserted to maximize the similarity GCCCAGCTTGAAAGCTGCGACTTCAAGGAGGACGGGCTCGTCAAGGACTGCGCTGCGCCC Cc-CATH2 actgtcccctcgctgccttccatccaataaaggtctttgctggtaaaaaaaaaaaaaaaa...
- 12
- 406
- 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot
... Control MnCl2 (1 mM) CuSO4 (1 mM) CaCl2 (1 mM) MgSO4 (1 mM) NAD (2 mM) Cystine (2 mM) 100 117.8 16.9 82.0 89.8 92.5 45.8 2-Mercaptoethanol (2 mM) GSH (2 mM) NADH (2 mM) EDTA (2 mM) NBT (5 mM) SOD ... Cloning of 1.5-kb DNA fragment A 320-bp DNA fragment located upstream of PTH270 (a differentiation-related promoter of Streptomyces coelicolor) was obtained by digesting pIJ4477 with SmaI and HindIII ... (GLGFLA) NaoA also displayed features that resemble those of 2-nitropropane dioxygenase from W saturmus var mrakii and those of nitroalkane oxidase from F oxysporum Both carbonyl compounds and...
- 6
- 255
- 0
Báo cáo y học: "Cloning, expression and characterization of gE protein of Duck plague virus" doc
... forward primer is 5'-AAAATAACATCGTGGGC-3', and the reverse primer is 5'-TTCGGTAGACTTTAG CATC-3' Using duck β-actin as the reference gene, the forward primer is 5'-CCGGGCATCGCTGACA-3', and the reverse ... post infection (Fig 5F5 ), these fluorescence granules was detected widely distributed in the cytoplasm, and became more bigger and brighter At 48 h post infection (Fig 5F6 ), the gE-specific fluorescence ... pET32a/DPV-gE antiserum The merged fluorescence microscopy images of DEF are shown in panels F1 to F7 with high magnification (600×) tent of DPV gE gene transcripts were calculated using the 2-ΔΔCt method...
- 11
- 282
- 0
Cloning, expression and characterization of novel helicobacter pylori differentiating antigen heat shock protein 20
... 96-97 Figure 4.10 Amplification of flanking DNA fragments and extraction of aphA gene 100 ii Figure 4.11 Identification of recombinant plasmids 101 Figure 4.12 Identification of recombinant plasmid ... side and brightening my life And thank my parents for their endless caring, encouragement and understanding i Table of contents Table of contents Content Page ACKNOWLEDGEMENT i LIST OF FIGURES ... my family for their incessant love and support throughout my PhD study Especially thank my husband Jieming Zeng, who himself was studying for PhD degree at the same time for always being on my...
- 301
- 525
- 1
Cloning, expression and characterization of oxysterol binding protein homologue 7 (OSH7) in yeast saccharomyces cerevisiae
... screening, OSH7 was amplified from yeast chromosomal DNA using Pfu polymerase The primers used were YHRF5: 5’-CGGGATCCTTGCTCTC AAAAACTAAAGAA-3’ and YHRF3: 5’-CCGCTCGAGCTAATTCTTTTGGATT CCATG-3’ 2.5.1.2 ... PCR amplification and purification PCR was performed using Promega PCR system 39.5 µl of ddH2O, µl of 10x PCR buffer, µl of 10 mM dNTPs mixture, µl of template DNA (0.5 g) and µl of both primers ... gene family was required for the vesicular trafficking, for the maintenance of intracellular sterol-lipid distribution, for membrane trafficking and for the integrity of vacuole morphology (Fang...
- 123
- 381
- 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... Osaka, Japan) To amplify the DNA fragments containing a complete x-5 gliadin gene, oligonucleotides, 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed ... Iijima Memorial Foundation for the Promotion of Food Sciences and Technology 4437 Cloning and expression of wheat x-5 gliadin References Dohi M, Suko M, Sugiyama H, Yamashita N, Tadokoro K, Juji F, ... and QQFHQQQ, are not common but might be important epitopes for the development of allergic symptoms in WDEIA We cloned and determined the nucleotide sequence of two x-5 gliadin genes, x-5a and...
- 8
- 484
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... T7- forward SP6-reverse GACTGTTGCTCATTTGTGGA GAGGCTAGATACTGCTCGATGT TGATGATTTGGAACCATTATTGAA CACCTTTTTCCTTCATCTTTTCAT ACTACCTCATGAAGATCCTG TTGCTGATCCACATCTGCTG TAATACGACTCACTATAGGG ATTTAGGTGACACTATAGAA ... to human and pufferfish (torafugu and spotted green pufferfish) IL-10 sequences Pufferfish and carp IL-10 genes, clustered together and distant from IL-20 and IL24, as recently determined from analysis ... sequence of mammalian IL-10 Carp IL-10 is 1096 bp in length and encodes a 180 amino acid protein similar to that of torafugu and mammalian counterparts Compared with other family members containing the...
- 8
- 584
- 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf
... LdUSP-RR2 GGCATCTGTTTCTTTGTCGCTTGTC CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 LdEcR-RF2 CCGTAGGAATGAGGGCAGAGTGTGT CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF1 LdUSP-RF2 GATTTGTCTTACGCTTGCCGGGAG GACAAGCGACAAACAGATGCC ... AAYTCNACDATNARYTGNACNGT LdUSP -F1 LdUSP -F2 LdUSP-R1 ATHTGYGGNGAYMGNGC GGNAARCAYTAYGGNGTNTA TCYTCYTGNACNGCYTC 5¢-RACE LdEcR-RR1 LdEcR-RR2 GGTGATATAGGCTTGACTCCGTTGA ACACACTCTGCCCTCATTCCTACGG LdUSP-RR1 ... USP Degenerate primers LdEcR -F1 LdEcR -F2 LdEcR -F3 LdEcR-R1 LdEcR-R2 LdEcR-R3 WSNGGNTAYCAYTAYAAYGC GARGGNTGYAARGGNTTYTT TGMGNMGNAARTGYCARGARTG TCNSWRAADATNRCNAYNGC CATCATNACYTCNSWNSWNSWNGC AAYTCNACDATNARYTGNACNGT...
- 15
- 564
- 0
Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx
... for which both values were obtained; mean ratios SE are given GTPase activity (nmolámg protein)1ámin)1) Protein lM Mg2+free 10 mM Mg2+free Ratio of GTPase activities (10 mM Mg2+free/5 lM Mg2+free) ... both GST±Rab31 (Fig 8A) and GST±Rab32 (Fig 8B), binding of [35S]GTP[S] (5 lM) reached a maximum within 30 at 37 °C when lM Mg2+free was present, whereas with 10 mM Mg2+free the binding of [35S]GTP[S] ... cDNA library, using as PCR primers, 5¢-TAGGATCCGCGATACGGGAGCTCAAAG-3¢ (P31-1) and 5¢-ATCTCGAGGATGTGGG- 262 X Bao et al (Eur J Biochem 269) CTCTGGCTTCT-3¢ (P31-2), containing BamHI and XhoI restriction...
- 13
- 481
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504 TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC ... TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648 CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca ... tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72 GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT...
- 11
- 527
- 0
Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt
... b-Actin FEBS Journal 272 (2005) 3828–3837 ª 2005 FEBS 5¢-AGTTCAACAAGGAACTGCAGGACGTGTTTG-3¢ 5¢-CACATGGCTATAAAATGGTTACATCTGTGT-3¢ 5¢-TATGTAGGAGCTACAAGAAACATTGAAGGC-3¢ 5¢-CAATTCTTACTAGCTGCAGGGAGGGTTGGT-3¢ ... 5¢-CAATTCTTACTAGCTGCAGGGAGGGTTGGT-3¢ 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢ 5¢-GCCTGAAGTTTTTGGTTCACAGTGAAATTT-3¢ 5¢-ACACTCTGAAGGGGAATTAGGATTAAGAAA-3¢ 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ 5¢-GAAAACACATCACGTACCCTCCCTCTCTGCG-3¢ 5¢-ACATCATGGTATATTATTCATTTAGCTGACACTTT-3¢ ... 5¢-ACATCATGGTATATTATTCATTTAGCTGACACTTT-3¢ 5¢-ATGGATGAGGAAATCGCTGCCCTGGTC-3¢ 5¢-TTAGAAGCACTTCCTGTGAACGATGGA-3¢ 3835 A novel zebrafish cytosolic sulfotransferase SULTs Total RNAs from zebrafish embryos and...
- 10
- 336
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008