... J D Baggot and R D Walker, 2000 Antimicrobial therapy in veterinary medicine Iowa State University Press/Ames 795 pp 26 Saavedra, M.J, S G Novais, A Alves, P Rema, M Tacao, A Correia and A M Murcia, ... 48 trang 24 Petersen, A. , J S Andersen, T.Kaewmak, T Somsiri, and A Dalsgaard, 2002 Impact of Integrated Fish Farming on Antimicrobial Resistance in a Pond Environment Applied and enviromental ... Sorgeloose, M Baele and A Decosrere, 2008 Antimicrobial susceptibility pattern of Edwardsiella ictaluri isolates from natural outbreak of bacillary necrosis of Pangasianodon hypophthalmus in Viet Nam Microb...
Ngày tải lên: 22/02/2014, 17:13
... Prasad, S and N Areechon 2010 Efficacy of formalin-killed Aeromonas hydrophila and Streptococcus sp vaccine in red tlapia Our Nature (8):231-240 Rahman, M.H and K Kawai 1999 Biological characteristics ... fish Aquaculture Health International 10-14 Das, A. , P.K Sahoo, B.R Mohanty and J.K Jena 2011 Pathophysiology of experimental Aeromonas hydrophila infection in Puntius sarana: Early changes in ... bacteria isolated from European eels Anguilla anguila reared in fresh water Diseases of Aquatic Organisms (16): 15-20 Evans, J., P.H Klesius and C .A Shoemaker 2006 Streptococcus in warm-water fish Aquaculture...
Ngày tải lên: 03/04/2014, 05:20
Bệnh do vi khuẩn Streptococcus spp
... với cường độ cao gây chết cá lượng lớn thời gian ngắn Cơ thể dẹt, có kích thước lớn -5 x -3mm, đ a bám ph a sau thân chia thành nhiều xoang xếp hình đối xứng, ph a cu i đ a bám có hai đôi móc sử ... sán đơn chủ ký sinh mang cá Mú thường gặp bao gồm Pseudorhabdosynochus spp, Megalocotyloides spp Diplectanum epinepheli Trong loài ký sinh trùng Pseudorhabdosynochus lantauensis phổ biến cá Mú ... ruột cá Giò Đối tượng nhiễm: Hầu loài cá nuôi biển Tác nhân gây bệnh: Magnacetabulum selari, giống Magnacetabulum, họ Dinuridae Ký sinh nhiều ruột cá Dấu hiệu bệnh lý: Khi cá nhiễm sán ruột thường...
Ngày tải lên: 02/10/2012, 10:07
Nghiên cứu đặc điểm sinh trưởng và phát triển của vi khuẩn Lactobacillus sporogenes
... L acidophilus Lactacin B L acidophilus 22 Lactacin F L acidophilus Bulgarin L bulgaricus Plantaricin SIK-83 L plantarum Plantaricin A L plantarum Lactolin L plantarum Plantaricin B L plantarum ... cha L sporogenes c sn xut ngy mt nhiu hn nh: Lactospoređ, Sporlacđ, SANVITA,ca Sabinsa Corporation, Lactopure ca Pharmed Medicare, NaturaFlorađ & NaturaFlora Kids Formula-Chewableđ ca Natura ... cultured dairy products Cultured Dairy Products J 18 : 6-19 Barefoot and Klaehammer, 1984 Purification and characterisation of Lactobacillus acidophillus bacteriocin lactacin B Antimicrobiological agents...
Ngày tải lên: 29/10/2012, 14:14
Tình hình nhiễm và sự nhạy cảm đối với kháng sinh của vi khuẩn salmonella spp. Trên heo tiêu chảy từ 1-3 tháng tuổi tại tỉnh trà vinh
... R.B, Anderson R.C, Nisbet D.J, 2001 Comparison of GN Hajna and tetrathionate as initial enrichment for Salmonella recovery from swine lymph nodes and cecal contents collected at slaughter Journal ... Vétérinaire du Quebec Soo Jin Yang, Kyoung Yoon Park, So Hyun Kim And Yong Ho Park, 2002 Antimicrobial resistance in Salmonella enterica serovars Enteritidis and Typhimurium isolated from animals ... animals in Korea: comparison of phenotypic and genotypic resistance charaterization Thong et al, 2002 Genetic diversity of clinical and environment strains of Salmonella enterica serotypes Weltewereden...
Ngày tải lên: 30/10/2012, 17:06
Khảo sát hệ vi khuẩn Methylobacterium sp.trên lúa ở Tây Ninh
... Dương O sativa complex O sativa AA + O glaberrima AA + O barthii AA + O glumaepatula AA O longistaminata AA O meridionalis AA O nivara AA O rufipogon AA + + + + + + + + + + O officinalis complex ... Appl Microbiol (in press as of 20 February 2006) M hispanicum Gallego, Garcia And Ventosa: Methylobacterium hispanicum sp nov and Methylobacterium aquaticum sp nov., isolated from drinking water ... FPGS1509: 5` AAGGAGGGGATCCAGCCGCA 3` FPGS6: 5` GGAGAGTTAGATCTTGGCTCAG 3` 2F: 5` GATCGGCCCGCGTCTGATTAG 3` 2R: 5` CCGTCATTATCGTCCCGGACA 3` Hình 3.1: Vị trí bắt cặp mồi vùng 16S rDNA Để định danh chủng...
Ngày tải lên: 05/11/2012, 13:59
Điều chế kháng huyết thanh thỏ và khảo sát đáp ứng miễn dịch của cá rô phi đỏ đối với vi khuẩn Streptococcus sp.
... đỏ Singapore chọn từ O mossambicus Mutante (Pruginin ctv.,1988), Florida cá lai F1 O mossambicus Albina X O urolepis hornorum (Sipe, 1985), Tailandesa chọn từ O.niloticus Roja, Manzala chọn từ ... lai O aureus Roja X O niloticus (Egipcia) Roja (Mc Andrew ctv., 1988; Tave, 1991), giống Yumbo No lai dạng Florida đỏ O niloticus (Castillo, 1990); giống Yumbo No lai Red Tilapia USA Red Tilapia ... lai Streptococcus sp.; cơng trình nghiên cứu nhóm nhà khoa học phòng thí nghiệm nghiên cứu sức khỏe động vật thủy, Bộ nơng nghiệp Hoa Kỳ ( Aquatic Animal Health Research Laboratary, ARS, USDA)...
Ngày tải lên: 17/11/2012, 09:40
Khảo sát vi khuẩn Methylobacterium sp. trên lúa ở tây ninh
... Dương O sativa complex O sativa AA + O glaberrima AA + O barthii AA + O glumaepatula AA O longistaminata AA O meridionalis AA O nivara AA O rufipogon AA + + + + + + + + + + O officinalis complex ... Appl Microbiol (in press as of 20 February 2006) M hispanicum Gallego, Garcia And Ventosa: Methylobacterium hispanicum sp nov and Methylobacterium aquaticum sp nov., isolated from drinking water ... FPGS1509: 5` AAGGAGGGGATCCAGCCGCA 3` FPGS6: 5` GGAGAGTTAGATCTTGGCTCAG 3` 2F: 5` GATCGGCCCGCGTCTGATTAG 3` 2R: 5` CCGTCATTATCGTCCCGGACA 3` Hình 3.1: Vị trí bắt cặp mồi vùng 16S rDNA Để định danh chủng...
Ngày tải lên: 17/11/2012, 09:42
Nghiên cứu phương pháp chiết xuất dịch từ sinh khối vi khuẩn lam Spirulina Platensis bổ sung vào nước giải khát
... hình sợi Vị trí phân loại khoa học Lãnh giới Bacteria Ngành Cyanobacterium Lớp Chroobacteria Bộ Oscillatorriales Họ Phormidiaceaea Chi Arthospira Các loài S maxima S platensis 2.2.2.2 Đặc điểm sinh ... researcher’s attention, because this alga contains more than 70% easily absorption protein, and 18/22 human essential amino acid and other nutrients The goal of this thesis is initially studying ... vii DANH MỤC CÁC CHỮ VIẾT TẮT BGBL Brilliant Green Bile Lactose BPA Baird Parker Agar CTV Cộng tác viên Ecoli Escherichia coli EMB Eosin Methylene Blue lactose F .A. O Food Agriculture Organization...
Ngày tải lên: 17/11/2012, 09:44
Khảo sát hệ vi khuẩn Methylobacterium sp. trên lúa ở tây ninh
... Dương O sativa complex O sativa AA + O glaberrima AA + O barthii AA + O glumaepatula AA O longistaminata AA O meridionalis AA O nivara AA O rufipogon AA + + + + + + + + + + O officinalis complex ... Appl Microbiol (in press as of 20 February 2006) M hispanicum Gallego, Garcia And Ventosa: Methylobacterium hispanicum sp nov and Methylobacterium aquaticum sp nov., isolated from drinking water ... FPGS1509: 5` AAGGAGGGGATCCAGCCGCA 3` FPGS6: 5` GGAGAGTTAGATCTTGGCTCAG 3` 2F: 5` GATCGGCCCGCGTCTGATTAG 3` 2R: 5` CCGTCATTATCGTCCCGGACA 3` Hình 3.1: Vị trí bắt cặp mồi vùng 16S rDNA Để định danh chủng...
Ngày tải lên: 19/11/2012, 15:12
KHÓA LUẬN TỐT NGHIỆP: NGHIÊN CỨU ĐẶC ĐIỂM SINH TRƯỞNG VÀ PHÁT TRIỂN CỦA VI KHUẨN Lactobacillus sporogenes
... L acidophilus Lactacin B L acidophilus 22 Lactacin F L acidophilus Bulgarin L bulgaricus Plantaricin SIK-83 L plantarum Plantaricin A L plantarum Lactolin L plantarum Plantaricin B L plantarum ... cha L sporogenes c sn xut ngy mt nhiu hn nh: Lactospoređ, Sporlacđ, SANVITA,ca Sabinsa Corporation, Lactopure ca Pharmed Medicare, NaturaFlorađ & NaturaFlora Kids Formula-Chewableđ ca Natura ... cultured dairy products Cultured Dairy Products J 18 : 6-19 Barefoot and Klaehammer, 1984 Purification and characterisation of Lactobacillus acidophillus bacteriocin lactacin B Antimicrobiological agents...
Ngày tải lên: 19/03/2013, 09:32
ĐIỀU CHẾ KHÁNG HUYẾT THANH THỎ VÀ KHẢO SÁT ĐÁP ỨNG MIỄN DỊCH CỦA CÁ RÔ PHI ĐỎ ĐỐI VỚI VI KHUẨN Streptococcus sp. (Bìa)
... MÔN CÔNG NGHỆ SINH HỌC KH A LUẬN TỐT NGHIỆP ĐIỀU CHẾ KHÁNG HUYẾT THANH THỎ VÀ KHẢO SÁT ĐÁP ỨNG MIỄN DỊCH C A CÁ RÔ PHI ĐỎ ĐỐI VỚI VI KHUẨN Streptococcus sp Giáo viên hướng dẫn: Sinh viên ... Streptococcus sp Giáo viên hướng dẫn: Sinh viên thực hiện: TS NGUYỄN HỮU THỊNH NGUYỄN VĂN HỮU NGÔ QUANG LUẬN Thành phố Hồ Chí Minh Tháng 9/2005 ...
Ngày tải lên: 19/03/2013, 09:39
ĐIỀU CHẾ KHÁNG HUYẾT THANH THỎ VÀ KHẢO SÁT ĐÁP ỨNG MIỄN DỊCH CỦA CÁ RÔ PHI ĐỎ ĐỐI VỚI VI KHUẨN Streptococcus sp. (Phần chính)
... 2003) Đoạn mồi RIV UIV BTA1 BTA2 Trình tự 5’ GTT TTA TTA TCC CAG CAA G 3’ 5’ TAT TCC TTT GGG GAG CA 3’ 5’ CCA ACT TTC CCT TCT TTC CC 3’ 5’ ATG GCC CAA AAG AAC ATT CA 3’ DNA mục tiêu nằm NST Y NST ... determination of bovine preimplantation embryos China Journal of Agricultural Biotechnology 1(1): 13-16 17 Delbrigde L M and Marshall Graves A J., 1999 Mammalian Y chromosome evolution and the male ... farm animals Lea and Febiger, Philadelphia, USA Chapter 28, p 386 – p 389 20 Haqq M C and Donahoe K P., 1998 Regulation of sex dimorphism in Mammals Physiol Rev 78: 1-33 21 Josso N., Rey R and...
Ngày tải lên: 19/03/2013, 09:39
Tình hình nhiễm và sự nhạy cảm đối với kháng sinh của vi khuẩn Salmonella spp
... R.B, Anderson R.C, Nisbet D.J, 2001 Comparison of GN Hajna and tetrathionate as initial enrichment for Salmonella recovery from swine lymph nodes and cecal contents collected at slaughter Journal ... Vétérinaire du Quebec Soo Jin Yang, Kyoung Yoon Park, So Hyun Kim And Yong Ho Park, 2002 Antimicrobial resistance in Salmonella enterica serovars Enteritidis and Typhimurium isolated from animals ... animals in Korea: comparison of phenotypic and genotypic resistance charaterization Thong et al, 2002 Genetic diversity of clinical and environment strains of Salmonella enterica serotypes Weltewereden...
Ngày tải lên: 19/03/2013, 16:04
Đặc điểm sinh trưởng và phát triển của vi khuẩn Lactobacillus sporogenes
... L acidophilus Lactacin B L acidophilus 22 Lactacin F L acidophilus Bulgarin L bulgaricus Plantaricin SIK-83 L plantarum Plantaricin A L plantarum Lactolin L plantarum Plantaricin B L plantarum ... cha L sporogenes c sn xut ngy mt nhiu hn nh: Lactospoređ, Sporlacđ, SANVITA,ca Sabinsa Corporation, Lactopure ca Pharmed Medicare, NaturaFlorađ & NaturaFlora Kids Formula-Chewableđ ca Natura ... cultured dairy products Cultured Dairy Products J 18 : 6-19 Barefoot and Klaehammer, 1984 Purification and characterisation of Lactobacillus acidophillus bacteriocin lactacin B Antimicrobiological agents...
Ngày tải lên: 07/04/2013, 20:14
ỨNG DỤNG OZONE XỬLÝ NƯỚC VÀ VI KHUẨN Vibrio spp. TRONG BỂ ƯƠNG ẤU TRÙNG TÔM SÚ
... Pudadera, Jr., J.O Potestas, K.G Corre, G .A Talean , L.F Bustilo, E.T Tech, A Unggui and T.E Chua 1986 Shrimp hatchery design, operation and management Network of aquaculture centres in Asia regional ... R.G 1986 Applications of ozone in water and wastewater treatment, Chapter In: Rice, R.G., L.J Bollyky and W.J Lacey (eds) 1986 Analytical aspects of ozone treatment of water and wastewater, Lewis ... Ozone In Water Treatment: Application and Engineering Cooperative Research Report, American Water Works Association Research Foundation, Compagnie Generale des Eaux, Lewis publishers Chelsea, MI...
Ngày tải lên: 22/04/2013, 17:19