0

lter a lter that allows you to search les for speci ed text

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

Đại cương

... door to affordable desktop publishing using such software packages as PageMaker that was then owned by Aldus, a company aptly named after the Italian inventor of the italic typeface The Apple Macintosh ... Knowledge Based Systems (KBSs), and neural networks (NNs) are perceived as part 33 Algorithm of AI Related areas include NNs and Rule-base systems, that are applied to automated decision making ... clients are Merchants that accept credit cards for customer payment transaction purposes Each Merchant is assigned an account into which is deposited the value of their card sales Batches of sales...
  • 379
  • 3,486
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Báo cáo khoa học

... database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech recognition language ... button you can search for all of the actor’s movies, by adding speech you can narrow the search to, for example, all of their comedies by saying: “show comedy movies with THIS actor” Multimodal ... System architecture The underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant fields...
  • 8
  • 585
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

Báo cáo khoa học

... retrieval track: A success story In Proc Content-Based Multimedia Information Access Conf., apr J Kupiec, D Kimber, and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence filtering ... interface is particularly applicable in a mobile context, in which text entry is slow and circumstances may prohibit speech altogether We fitted a 3-gram language model to the same corpus as above ... Dragon Audio Setup Wizard identi ed the signal -to- noise ratio as 22 dBs.) We tested a male native speaker of English and a female non-native speaker, requesting each first to train the acoustic...
  • 4
  • 276
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học

... 1: Architecture This architecture forms an ideal platform for the implementation of the phonological interface Necessary adaptions are limited to the data used: An existing grammar was extended ... tactical generator only candidate positions for both pitch accents and phrasal boundaries are selected This reflects the fact that though prosody heavily depends on grammaticM and pragmatic factors, ... syntactic sugar enables us to keel) the rule formulations over the collapsed representation economical and relatively transparent We note in passing that although collapsing multilinear data-structures...
  • 5
  • 498
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học

... ı a Measures for Automatic Machine Translation Evaluation Machine Translation, 24(3–4):77–86 Ahmed El Kholy and Nizar Habash 2011 Automatic Error Analysis for Morphologically Rich Languages In ... Jos´ B c a e Mari˜ o, Deepa Gupta, Marcello Federico, Patrik Lamn bert, and Rafael Banchs 2006 Morpho-Syntactic Information for Automatic Error Analysis of Statistical Machine Translation Output ... unfriendly for MT developers that need to manually analyze and compare speci c aspects of their systems During the evaluation process, A SIYA generates a number of intermediate analysis containing partial...
  • 6
  • 453
  • 0
Lab 3.1.5 Configuring a Serial Interface

Lab 3.1.5 Configuring a Serial Interface

Quản trị mạng

... typing enable If prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config ... Enter the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by issuing ... router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for...
  • 5
  • 341
  • 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Quản trị mạng

... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD ... the running configuration for the next time that the router is restarted The router can be restarted either by a software reload command or a power shutdown The running configuration will be lost ... refer to the Configuring router passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config)#interface...
  • 5
  • 535
  • 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Quản trị mạng

... typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... identify what type and how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for ... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced...
  • 6
  • 368
  • 0
Tài liệu Troubleshooting a Serial Interface doc

Tài liệu Troubleshooting a Serial Interface doc

Quản trị mạng

... typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... identify what type and how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for ... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced...
  • 6
  • 275
  • 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Quản trị mạng

... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD ... the running configuration for the next time that the router is restarted The router can be restarted either by a software reload command or a power shutdown The running configuration will be lost ... refer to the Configuring router passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config)#interface...
  • 5
  • 431
  • 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Quản trị mạng

... typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... identify what type and how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for ... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced...
  • 6
  • 323
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Báo cáo khoa học

... the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classi ed to determine ... makes the class covariances closer to the overall data covariance, and therefore to each other, thus making the quadratic boundary more similar to a linear boundary Shrinkage is applied as ˆ ˆ ˆ ... principal components analysis) is learned using training data and is subsequently applied to the EEG data when the system is being used Fourth, the data vectors obtained for each channel and a given...
  • 6
  • 551
  • 0
Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx

Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx

Phần cứng

... giống 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~  Mạch ASIC ( Application Specific Integrated Circuit ): não ổ đ a Flash USB Nó gồm có xử lý trung tâm 50 MHz ARM7 RISC, quản lý to n chuyện ghi đọc liệu ... NAND thông dụng rẻ 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Sau lớp ổ đ a, gồm có phần sau:  Một mạch in ( printed circuit board ) đựoc hàn chung với nhớ ổ đ a nhiều thành phần khác Các nhà sản xuất ... nhanh dễ dàng  So với cách kết nối thiết bị với máy tính dùng cổng song song (Parallel Port), dùng cổng nối tiếp (Serial Port) hay dùng Card đặc biệt thiết kế cài đặt sẵn bên máy tính USB nhanh...
  • 19
  • 471
  • 1
AN1157   a serial bootloader for PIC24F devices

AN1157 a serial bootloader for PIC24F devices

Cao đẳng - Đại học

... current data files and saves them to a specified HEX file The program uses the formatted text file for storage and display When importing a file, always be certain that the HEX file is padded and aligned ... Data EEPROM Operations Some PIC24F devices have built-in data Flash memory EEPROM The bootloader allows data Flash to be read and erased at a word level, bytes at a time Erases are done on a ... following a as data, and will always send a before any of the three control characters For example, if a byte of value, 55h, is transmitted as part of the data field, rather than as the...
  • 26
  • 532
  • 0
Serial Interface (SCI)

Serial Interface (SCI)

Kỹ thuật lập trình

... repeatedly It is assumed that SCI channel is initialized for 8-bit data, one stop bit, no parity, no interrupt, and a transfer speed of 9600 bps No error check is made on received data As a character ... started immediately You must wait for the time required for at least bit to be communicated at the set speed This is the time required for the SCI to be initialized, hence the need to wait for ... start-stop synchronization: one is for the sender and receiver to use the same data format and the other is for them to use the same transmission speed (also called "baud rate", which refers to...
  • 18
  • 289
  • 0
Serial Interface to PIC

Serial Interface to PIC

Kỹ thuật lập trình

... Displaying Data on HyperTerminal 73 A shortcut to the configuration file can be created and placed on the desktop for easy reference HyperTerminal setup procedure is described in many technical manuals ... is smaller in size and requires no external capacitors The applications developed in this chapter resorts to MAX-232 for achieving compatibility Online tutorials for indepth information regarding ... corresponds to an “ON” or 0-state (SPACE) condition −3 to −12 V corresponds to an “OFF” 1-state (MARK) condition +3 to −3 V corresponds to the “dead area” kept to absorb line noise A standard serial interfacing...
  • 10
  • 271
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

Báo cáo khoa học

... interface allows for both simple search and advanced search, depending on the type and needs of the users The advanced search is designed for those who have a special interest in multimedia semantics ... application needs had to be taken into consideration The main goal was to develop a text- based search engine module capable of handling les in the xml format and accessed by local and remote users ... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a...
  • 4
  • 294
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

Báo cáo khoa học

... program database Response statements to input statements may take various forms depending on the patterns and current circumstances, and they are here generated by taking into account slot information, ... showed that all subjects could access information on desired programs In a subsequent questionnaire, moreover, all subjects stated that “program selection was easy, and particularly there was ... no need to know about hierarchical structure of program information.” On the other hand, the test also revealed that some issues remain to be addressed in speech recognition but that a favorable...
  • 4
  • 271
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Hóa học - Dầu khí

... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... ACTGTTCAAGCCTCCAAGCTGTGCCTTGG GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT ... amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
  • 7
  • 404
  • 0

Xem thêm