log in as root and open a terminal window if export home doesn t exist create it
báo cáo khoa học:" Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial" pot
... Hospital Dental College, Mumbai in association with Bhabha Atomic Research Centre and Topiwala National Medical College, Mumbai Thirty patients with (OSMF/L and 30 patients with OSCC with histopathologically ... that no aspect of total patient care has been more important than the modern concepts of prevention, diagnosis, treatment and their systemic relationship The rate at which oral precancerous and ... patients can help not only in the early diagnosis, appropriate treatment but also as indicators of prognosis, as the disease progresses Materials and methods This study was carried out in Nair...
- 10
- 317
- 0
REPRODUCTIVE, MATERNAL AND CHILD HEALTH IN EASTERN EUROPE AND EURASIA: A COMPARATIVE REPORT ppt
... health areas that warrant greater attention These data may be translated into policy and programmatic activities to improve services and findings may provide guidance on how data may be combined ... conditions in the region As a result, until recently, relatively little detailed and reliable population-based information was available about the situation in the region with regard to important reproductive ... Suggested citation: Centers for Disease Control and Prevention and ORC Macro 2003 Reproductive, Maternal and Child Health in Eastern Europe and Eurasia: A Comparative Report Atlanta, GA (USA) and Calverton,...
- 15
- 314
- 0
Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc
... occurs in social contexts, and meaning is instantiated through language use Grabe and Kaplan [5] also emphasize that only teachers who understand theory and make a transition from theory to practice ... portfolio assessment, which meets the two most important characteristics of a test, that is, validity and reliability (Bachman, [19]), as well as reduces the pressure of testing that students are ... be a grading schema for the teacher to the final evaluation The teacher will make the checklists understandable to students by training students to use them All of these can facilitate teachers...
- 6
- 704
- 1
Thesis: Directness in conversations in american english and vietnamese A comparative study
... deepening people‟s relationship “Even the most casual of conversations have an interactional function Casual conversations in parties can have the practical task of ascertaining whether the future ... affirms that conversations usually occur in strings of related and combined utterances It means that each speaker is affected by what the previous speaker said, and what speaker says affects what the ... appraisal of a person, situation, event, etc.), and trash talk (talk in competitive settings, notably athletic games, that is boastful and puts down opponents) (Arthur, 2001,p 2) Moreover, directness...
- 53
- 623
- 3
Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps
... showed the lowest N concentrations at the least fertile Danish site (DK-1) and two Lithuanian sites At the Danish site the growth rate, was also probably affected (Tab I) although the other elements ... (1.0) a Cation exchange capacity was determined as the sum of the extractable amounts of H+, Na+, K+, Ca+, Mg2+, Al3+, Fe3+ and Mn2+ from the BaCl2 extraction b Base saturation was calculated as the ... plots (of about 400 m2) containing different species planted at the same time, in adjacent or closely situated stands, were investigated (Tab I) Three Lithuanian sites were situated along the...
- 10
- 443
- 0
báo cáo khoa học:" Quality of life among patients receiving palliative care in South Africa and Uganda: a multi-centred study" ppt
... physical symptoms It is vital to identify and meet the psychological and spiritual care needs of patients, as well as to assess and manage pain and other symptoms and functional limitations in this ... psycho-spiritual wellbeing than AIDS patients in the Ugandan study [44] This may relate to the physical and psychological burden of living with AIDS and the fact that the patients in the Ugandan study ... identify and meet the psychological and spiritual care needs of patients, as well as to rigorously assess and treat pain and other symptoms, and support patients in coping with their functional...
- 14
- 229
- 0
Báo cáo y học: "Homeostatic mechanisms in dopamine synthesis and release: a mathematical model" pptx
... mechanisms are not certain, research since that time has demonstrated clearly that the autoreceptors modulate the activity of TH as well as the neuronal firing rate and the release of dopamine[29,28,61-63,30,64,31] ... from the data in figure of [23] The number 0.56 in the numerator is chosen so that at steady state the overall value of this term is one That means the the steady states with and without substrate ... dopamine transporters (DATs) on the terminal and it is thought that the DATs play an important role in extracellular dopamine homeostasis [24,25] Autoreceptors are found on most parts of dopaminergic...
- 20
- 367
- 0
INTUITION USE IN FOOT, THOMSON, AND KAMM a CASE STUDY
... the Meanings and Functions of "Intuition" and Cognate Terms Non-technical characterisations • If a thing is "intuitive", then it has a certain effortlessness and spontaneity about it • • eg an ... "intuition", as well as its more technical meanings, meanings that philosophers have associated with it Here are some of the things that "intuition", "intuitive", and "intuitively" could mean: Taxonomy ... of it I have to deeply imagine myself in a certain situation, with an open mind It is almost as if you are looking at something with no preconceptions You have to attend to it, and then things...
- 90
- 249
- 0
Chasing the negawatt energy efficiency in british homes and businesses a policy perspective
... central heating – even as its population rises and per capita demand for energy increases The majority of the cuts will be generated in three target areas: the national energy mix; transport; and ... Indeed, at the time of writing Scottish Power had just announced a 19% increase in its gas tariff and a 10% increase in its electricity price Accordingly, 80% of consumers say that reducing their ... businesses are often far more rational than consumers, at least once targets have been set: they will then calculate a way forward and chase after potential savings At home, such rationality is less...
- 24
- 251
- 0
122PART TWO Trading System$20.70 is a good idea, because this level doesn’t show good support. docx
... using the relative strength of a particular stock as an indication of its being a likely candidate Also keep in mind that this approach is useful as a backup plan in trending markets As the market ... superimpose its chart onto that of the NDX to find out how much in sync they are The best trading candidates are those that move with a slight lag because this allows using the NDX as the leading indicator ... percent; and the last, 62 percent In cases such as this, traders have two options They can trail the stop tighter to the $141/4 area where the first retracement level is or trail it to the last retracement...
- 27
- 283
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... match the potential a- helical dimer found here The interpretation of the potential dimeric state as the transition state to b-fibril formation would also match recent solidstate and liquid-state ... contains apolar side chains and it can be assumed that it is situated at the hydrophobic palmitoyl chains of the surfactant phospholipids In this environment, hydrogen-bonding interactions and ... correlated to the Ha and side chain protons The spin systems of Lys10 and Arg11 are indicated by rectangles as both contain a second HN in the side chain The N -terminal Gly1 appears as a weak and...
- 10
- 426
- 0
Báo cáo lâm nghiệp: "Morphological and functional variability in the root system of Quercus ilex L. subject to confinement: consequences for afforestation" ppt
... pruning of roots Continual air pruning induces a limitation to the main root growth by shortening its length to the depth of the container and preventing the development of replacement taproots The ... was placed at the bottom of the tubes to prevent substrate movement and to facilitate root air pruning As container volume has a clear in uence on root system morphology [9, 21, 28], this parameter ... noteworthy In particular, the root system obtained in ST could not be ascribed to a dichotomous model, as initially expected This finding suggests that the root system produced by a standard container...
- 6
- 371
- 0
Báo cáo lâm nghiệp: "Fine root distribution, seasonal pattern and production in four plantations compared with a natural forest in Subtropical China" docx
... monthly rainfall The decline in fine root biomass during the winter season may, at least in part, be mainly related to low temperature conditions This seasonal pattern of fine root biomass (maximum ... hodginsii (FH), Ormosia xylocarpa (OX) and Castanopsis kawakamii (CK), and an adjacent natural forest of Castanopsis kawakamii (NF): (1) fine -root biomass, distribution and seasonal patterns; and ... reported tree stands showing no distinct seasonal pattern [24] and those with one [22] or two [11] statistically significant peaks Peaks in standing fine root biomass have been measured in spring...
- 11
- 266
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx
... transmitted disease) clinics that show increased testing rates and patient receipt of test results after implementation of structural changes, such as improved staff training in pre- and post-testing ... physician assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation ... and analytical evaluation, determine the sustainability of our project in our initial two-stations, determine the institutionalization of behaviors by our two-station pilot, and further refine and...
- 13
- 341
- 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx
... transmitted disease) clinics that show increased testing rates and patient receipt of test results after implementation of structural changes, such as improved staff training in pre- and post-testing ... physician assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation ... and analytical evaluation, determine the sustainability of our project in our initial two-stations, determine the institutionalization of behaviors by our two-station pilot, and further refine and...
- 13
- 588
- 0
Báo cáo y học: " Health status and lifestyle factors as predictors of depression in middle-aged and elderly Japanese adults: a seven-year follow-up of the Komo-Ise cohort study" doc
... Okinawa, Japan 3NPO International Ecohealth Institute, Isesaki, Japan Authors’ contributions HT was involved in data analysis and interpretation of the results, in addition to writing the manuscript ... the data analysis and contributed to interpretation of the results and editing the manuscript All authors contributed the interpretation and discussion of the results They read and approved the ... demographic characteristics, health status, lifestyle factors and social networks, and also included the Todai Health Index (THI) [18], which quantitatively represents mental and physical complaints...
- 10
- 480
- 0
Báo cáo khoa học: " Correlation between HIV viral load and aminotransferases as liver damage markers in HIV infected naive patients: a concordance cross-sectional study" pdf
... mitochondrial membrane by HIV proteins which stimulate an inflammatory response [9-16] Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are hepatic enzymes that could be used as markers ... without antiretroviral experience Based in our results, it is possible that patients with an increase in aminotransferases could be potentially benefited with HAART These results indicate that clinicians ... Pasquazzi Z, Aceti A: Correlation of serum aminotransferases with HCV RNA levels and histological findings in patients with chronic hepatitis C: the role of serum aspartate transaminase in the evaluation...
- 4
- 225
- 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
... CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT AGTGGTCATGGATGACTTTGG Product size ... assays and revised the manuscript for important intellectual content HB participated in the design of the study and performed statistical analysis and data interpretation MMB participated in the ... cells and extracellular matrix In addition, breast cancer tissue maintained in short term culture was previously shown as a potential model to study the activity of drugs (i.e paclitaxel) and hormones...
- 9
- 337
- 0
Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx
... HIV-1 diagnostic tests Is it possible that the antibody response detected was against a related retrovirus such as XMRV? If XMRV is indeed circulating in the human population, it has important implications ... finding of XMRV in prostate tumours and CFS patients in the USA has to be treated with great caution In the past, numerous retroviruses have been reported in human tissues and cultured cells (for review ... remains to be done At this early point in XMRV research, areas should be identified in which this virus may cause a serious impact on human health One of these areas may be the xenotransplantation...
- 3
- 290
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008