lipoprotein structure and dynamics low density lipoprotein viewed as a highly dynamic and flexi
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot
... meanings, grammar, and pragmatic or local context, receive support as separately definable knowledge within studies of aphasia There is a vast l i t e r a t u r e concerning what aspects of language ... neurolinguistic l i t e r a t u r e demonstrates that the grammar can be affected in isolation from other aspects of language function (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough, ... syntactic category aspect of each meaning of a phonetic word is also a part of the grammatical representation where i t makes associations with other syntactic categories The associations...
- 9
- 379
- 0
Báo cáo y học: "Chlamydia trachomatis diversity viewed as a tissue-specific coevolutionary arms race" pot
... Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H: Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory ... data, and wrote the manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is a figure showing the overall mean ... revealed by whole genome PCR scanning Proc Natl Acad Sci USA 2002, 99:17043-17048 Ogura Y, Ooka T, Asadulghani , Terajima J, Nougayrède JP, Kurokawa K, Tashiro K, Tobe T, Nakayama K, Kuhara S,...
- 13
- 258
- 0
Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx
... course data with a two-exponential association model kobs(rapid) and kobs(slow) are the observed association rate constants for the rapid and slow association phases, respectively The values for ... plateau)*exp() KX) + plateau or the two-phase exponential decay equation Y = plateau + SpanFast*exp() KFastX) + SpanSlow*exp() KSlowX) The data were also analyzed by plotting dissociation data ... internalization and whether the rate constants of association and dissociation for [125I]TCPCSK9 at 37 °C are similar to values obtained at °C Our preliminary data indicate that HepG2 cells are able...
- 13
- 712
- 0
Tài liệu Báo cáo khoa học: Glycation of low-density lipoprotein results in the time-dependent accumulation of cholesteryl esters and apolipoprotein B-100 protein in primary human monocyte-derived macrophages docx
... using BSA as a standard Data analysis Data are expressed as mean ± SEM from three or more separate experiments with triplicate samples One-way or two-way analysis of variance (anova) was used ... supported by grants from the Diabetes Australia Research Trust and the Australian Research Council B E Brown and I Rashid gratefully acknowledge receipt of Australian Postgraduate Awards administered ... cell medium samples were collected, and the cells were washed and lysed in water Cell viability was determined by assaying lactate dehydrogenase release, and cellular cholesterol and cholesteryl...
- 12
- 604
- 0
Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt
... capsaicin and their combination on the damage caused to liver by iron overloading measured in terms of lipid peroxidation and elevation of plasma alanine aminotransferase (AlAT), aspartate aminotransferase ... be assessed by leakage of enzymes such as alanine aminotransferase (AlAT), aspartate aminotransferase (AsAT) and lactate dehydrogenase into blood [52,53] Higher activities of all these three enzymes ... described by Yagi [27], using 1,1,3,3-tetraethoxypropane as reference Serum enzymes Plasma-nonspecific enzymes, aspartate aminotransaminase (AsAT, EC.2.6.1.1) and alanine aminotransaminase (AlAT, EC.2.6.1.2),...
- 10
- 498
- 3
Báo cáo khoa học: Anti- and pro-oxidant effects of quercetin in copper-induced low density lipoprotein oxidation Quercetin as an effective antioxidant against pro-oxidant effects of urate potx
... classical shape characterized by a lag time followed by a linear increase until a maximum is reached Then they slowly decay [45] When separately added, 10 lM urate decreases the lag-time whereas ... Polyphenolic flavanols as scavengers of aqueous phase radicals and as chain-breaking antioxidants Arch Biochem Biophys 332, 339–346 19 Tikkanen, M., Wahala, K., Ojala, S., Vihma, V & Adlercreutz, ... investigation appears sensible as it was recently demonstrated [36] that, at low concentration, urate may behave as a pro-oxidant Moreover, in an earlier report it was suggested that flavonoids and urate could...
- 9
- 504
- 0
Báo cáo Y học: Structural and compositional changes in very low density lipoprotein triacylglycerols during basal lipolysis potx
... acylglycerols, assuming 1-random, 2-random and 3-random distribution [27] The molecular associations give the exact pairs of fatty acids in individual diacylglycerol and the exact triplets of fatty acids ... were prepared after partial deacylation of plasma VLDL triacylglycerols and they were separated and analysed by HPLC/MS as described in Methods Results are expressed as mean ± SD for five rats per ... hydrolysis of 20:4 containing triacylglycerol and diacylglycerol was slower in rat postheparin plasma when hepatic lipase was inhibited [36] Hepatic lipase is capable of hydrolysing fatty acids from the...
- 10
- 412
- 0
Báo cáo Y học: Anti- and pro-oxidant effects of urate in copper-induced low-density lipoprotein oxidation pdf
... preparations were rst incubated with Cu2+ and then urate was added after LPO started As already shown in Fig 1, urate at high concentration added before Cu2+ behaves as an antioxidant In contrast, ... increasing or decreasing phases, because different LDL preparations we used to get data at least in triplicates As to the MDA formation, Fig 2A and C fully conrm the pro-oxidant activity of low ... Free Radic Biol Med 22, 411421 Nyssonen, K., Porkkala-Sarataho, E., Kaikkonen, J & Salonen, J.T (1997) Ascorbate and urate are the strongest determinants of plasma antioxidative capacity and serum...
- 10
- 415
- 0
Báo cáo y học: " Patients with early rheumatoid arthritis exhibit elevated autoantibody titers against mildly oxidized low-density lipoprotein and exhibit decreased activity of the lipoprotein-associated phospholipase A2" pot
... phase, and plasma lipoprotein phospholipase A2 activity as defined from univariate analysis after adjustment for age and female gender Page of (page number not for citation purposes) Available ... Correlation between HDL-associated lipoprotein- associated phospholipase A2 (HDL-Lp-PLA2) activity and autoantibody titers against oxLDLD in early rheumatoid arthritis patients at baseline Page ... Lp-PLA2 activities and elevated autoantibody titers against mildly oxLDL The low plasma Lp-PLA2 activity and the increased titers against oxLDLD are independently associated with ERA, suggesting an...
- 8
- 292
- 0
Functional role of low density lipoprotein receptor related protein 5 and 6 in alzheimers disease
... microglial cells indicated that the endolytic degradation of A was dramatically enhanced by apoE3 rather than apoE4 [69] Moreover, apoE4 potentiated A -induced lysosomal leakage and apoptosis, leading ... β-amyloid BLAST Basic Local Alignment Search Tool BSA bovine serum albumin C83 C-terminal fragment 83 C99 C-terminal fragment 99 CIP Calf Intestinal Alkaline Phosphatase CK1 casein kinase CNS central ... intracellular domain The image was taken from Ref [38] 1.2.2 Late-onset AD Over 99% of AD cases occur late in life (>65 years) and are referred as late-onset AD (LOAD) Genome-wide association...
- 157
- 264
- 0
Cellular gene expression profiles of human macrophages exposed to chlamydia pneumoniae and treated with low density lipoprotein
... which are Chlamydia pneumoniae, low density lipoprotein and macrophage; and not due to Chlamydia pneumoniae alone In the fourth model, low density lipoprotein was added to the macrophages and allowed ... the bacteria Chlamydia pneumoniae, is added to the macrophages first and allowed to interact with the macrophages for 72 hours; and then after which low density lipoprotein is added and allowed ... interact with the macrophages for 24 hours; and then after which the bacteria Chlamydia pneumoniae, is added, and allowed to interact with both the macrophages and low density lipoprotein for another...
- 199
- 188
- 0
Báo cáo khoa học: Protective effects of endomorphins, endogenous opioid peptides in the brain, on human low density lipoprotein oxidation pdf
... of an antioxidant molecule, AH, either the initiating peroxyl radical and ⁄ or the propagating lipid peroxyl radical can be trapped and a • • new antioxidant radical, A , produced If the A is a ... diseases, such as rheumatoid arthritis, ischaemia–reperfusion injury to heart muscle and Alzheimer’s disease [42] Protein carbonyl formation is a biomarker of protein oxidation and has some advantages ... 0.5% agarose gels and stained with Sudan Black B The REM was defined as the ratio of migrating distance of oxidized LDL to that of native LDL Statistical analysis Results are expressed as mean ±...
- 10
- 558
- 0
Báo cáo khoa học: Binding areas of urokinase-type plasminogen activator– plasminogen activator inhibitor-1 complex for endocytosis receptors of the low-density lipoprotein receptor family, determined by site-directed mutagenesis doc
... acetic acid, pH 2.6, and 0.1 m NaCl The remaining radioactivity was dened as internalized ligand Internalized and cell surface-associated ligand were expressed as a percentage of the total radioactivity ... the same way as uPAPAI-1 except that an anti-uPA mAb2-coupled Sepharose column was used instead of an anti-uPA mAb6coupled Sepharose column To prepare nonradioactive wild-type and mutant uPA PAI-1 ... model was poor As appears from Fig 5, the rapid rst phase of the association was followed by a second, slower phase, and a corresponding rapid dissociation phase, amounting to 20% of total binding,...
- 17
- 269
- 0
Báo cáo y học: "Autoantibodies to low-density-lipoprotein-receptor-related protein 2 (LRP2) in systemic autoimmune diseases" pps
... 5′-TTTggatccACTGATGAGACAGAGGAGCACTGT-3′ and 5′-TTTgtcgacATCAACAGCTTGGATATATTCCTCATC-3′ for cDNAF6 (N11826–12374), 5′-TTTgaattcCGAAAATATAATCTCTCATCT-3′ and 5′-TTTgtcgacCTGTTTGCAAAGGTTGGGCACTGA-3′ ... 5′-TTTgtcgacAAAAATGAGATAGGGTTCGATGTTA-3′ for cDNAF2 (N9294–9713), 5′-TTTgaattcAACAGTAACATCGAACCCTATCTC-3′ and 5′-TTTgtcgacATTGTTGGTACCACAGGGATTGC-3′ for cDNAF3 (N9684–10523), 5′-TTTggatccAATCCCTGTGGTACCAACAATGGT-3′ ... 5′-TTTggatccAATCCCTGTGGTACCAACAATGGT-3′ and 5′-TTTgtcgacACAGCCTTGCTCATCACTGTTGTC-3′ for cDNAF4 (N10494–11180), 5′-TTTgaattcGAATTCAGCTGCAAAACAAATTAC-3′ and 5′-TTTgtcgacCTCTGTCTCATCAGTTCCATCTCC-3′ for cDNAF5 (N11157–11855),...
- 7
- 285
- 0
Báo cáo y học: "Inhibition of lectin-like oxidized low-density lipoprotein receptor-1 reduces leukocyte adhesion within the intestinal microcirculation in experimental endotoxemia in rats" potx
... 5’-CGGGATCCAAGAATCAAAGAGGGAACTGAA-3’ (5’-end) and 5’-CCGCTCGAGACCTGAAGAGTTTGCAGCTCT-3’ (3’-end), which introduced BamHI and XhoI restriction sites (underlined) The BamHI/XhoI-fragment was then ... investigations of values in multifactorial design were examined by means of two-way analysis of variance (two-way repeated-measures ANOVA) A value of P < 0.05 was considered statistically significant ... Western blot, and RT-PCR analysis SW and CT carried out intravital microscopy ML and CL conceived of the study, analyzed data, and drafted the manuscript DP, MM, and VC made substantial contributions...
- 8
- 219
- 0
Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx
... experimentally obtained relaxation rates R1 (longitudinal or spin–lattice relaxation rate) and R2 (transverse or spin–spin relaxation rate) and NOE values for the amide 15N nuclei measured at 278 K, and ... ª 2007 The Authors Journal compilation ª 2007 FEBS 4233 NMR structure and dynamics of eRF1 middle domain E V Ivanova et al saturation was applied as a relaxation delay for NOE enhancement in ... relaxation data Protein Sci 9, 1210–1216 71 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database...
- 15
- 538
- 0
Báo cáo khoa học: Solution structure and backbone dynamics of the XPC-binding domain of the human DNA repair protein hHR23B docx
... excision repair J Biol Chem 278, 7476–7485 Masutani C, Araki M, Sugasawa K, van der Spek PJ, Yamada A, Uchida A, Maekawa T, Bootsma D, Hoeijmakers JH & Hanaoka F (1997) Identification and char- FEBS ... Solvent-accessible surface areas of XPCB–hHR2 3A and B The solvent-accessible surface areas and their deviations for each residue are shown for two XPCB–hHR2 3A structures; Waters et al [13] (A1 ), Kamionka and Feigon ... the ATPase domain of Hsp70-like Stch FEBS Lett 467, 348–355 Araki M, Masutani C, Takemura M, Uchida A, Sugasawa K, Kondoh J, Ohkuma Y & Hanaoka F (2001) Centrosome protein centrin ⁄ caltractin...
- 10
- 431
- 0
Báo cáo khoa học: Plasmodium falciparum merozoite surface protein 1 Glycosylation and localization to low-density, detergent-resistant membranes in the parasitized erythrocyte pdf
... b-1,4-galactosyltransferase was from Calbiochem b-galactosidase (bovine brain) and b-N-acetylglucosaminidase (Jack Bean) were from Sigma Metabolic radiolabelling of M25 Zaire P falciparum parasites Asexual blood stage ... immunoprecipitated 19 kDa protein was detectable only as a single 19-kDa band The only strong [3H]GlcN-labelled band in the total extract matching the Western blotted material was a 17-kDa band The majority ... P04933) were aligned according to [23] and designated as G (Ghana), P (Png MAD20), U (Uganda), T (Thai) and W (Wellcome) Alpha- and b-GlcNAc site predictions, made using methods based on neural networks,...
- 10
- 415
- 0
Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx
... CGCGCTAGCATGATCAAGGACTGTGGG CAGCCC and CGCGAATTCTCACACTGGCAAGC ACCGAGGAATCT; CCP1CCP2: CGCGCTAGCATGATCATCAAGTGCC CCCAGCCC and CGCGAATTCTCACACTGGCAA GCACCGAGGAATCT; CUB2CCP1: CGCGCTAGCATGACTCAGGCTGAG ... CGCGCTAGCATGACTCAGGCTGAG TGCAGCAGC and CGCGAATTCTCAGTCCTTGA TCTTGCATCTGGG; CUB2CCP1CCP2: CGCGCTAGCATGACTCAGGCT GAGTGCAGCAGC and CGCGAATTCTCACACT GGCAAGCACCGAGGAATCT The PCR products were digested with NheI and EcoRI ... (R2) relaxation, as well as {1H}-15N NOE measurements, were made at 11.7 T These relaxation data were acquired and analyzed for both CCPsingle modules at pH 4.0–4.5 and pH 7.0 at 300K (Table S1)...
- 13
- 583
- 0
Báo cáo khoa học: Refined solution structure and backbone dynamics of the archaeal MC1 protein ppt
... NMR structure and backbone dynamics of MC1 F Paquet et al HTa, a member of the HU family [5,6] Sac7d and Cren7 have a small b-barrel with or without an amphiphilic C-terminal a- helix, and HUs have ... 15N-relaxation parameters (R1, R2, and NOE) for MC1 NMR relaxation experiments were measured at 299 K on a Varian 500 MHz (NOE), Varian INOVA 600 MHz (NOE, R1 and R2) and Varian INOVA 800 MHz (R1 and ... that have enabled us to assign all side chains and to introduce dihedral angle restraints (u and w angles) Residual 5134 dipolar couplings (RDCs) were also measured in a partially aligned sample...
- 13
- 387
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose