lava with a lower silica content is more fluid and may travel a long distance before congealing
Low Occurrence of Tuberculosis Drug Resistance among Pulmonary Tuberculosis Patients froman Urban Setting, with a Long-Running DOTS Programin Zambia docx
... contributions made to this paper by Webster Kasongo and David Mwakazanga at the Tropical Diseases Research Centre, Zambia in study coordination and data analysis, respectively Finally, the authors thank ... [6] Central Statistics Office, “Zambia 2000 Census of Population and Housing,” Summary Report, Lusaka, Zambia, 2003 [7] Ministry of Health, Tuberculosis and TB/HIV Manual, The National TB and Leprosy ... 2006 [20] D A olabi, O A Adjagba, B Tanimomo-Kledjo, M Gninafon, S Y Anagonou, and F Portaels, “Anti-tuberculosis drug resistance among new and previously treated pulmonary tuberculosis patients...
- 6
- 329
- 0
Báo cáo y học: "Background: Percutaneous tracheostomy (PT) has gained an increasing acceptance as an alternative to the conventional surgical tracheostomy (ST). In experienced hands, and with proper patient selection, it is safe, easy and quick." docx
... the trachea is carried out with the needle directed cranially and the tracheal cannula inserted with a pull-through technique along the orotracheal route The cannula is then rotated downward using ... procedure can be carried out under endoscopic guidance only, and rotating the tracheal cannula downward may pose a problem, thus demanding more experience There is also an apnea phase of about 60–90 ... pressure on the trachea and pretracheal tissue It has also been successfully carried out on infants and children [7] It may be particularly useful in patients with bleeding diathesis and goiter The...
- 6
- 342
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... 29 Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR Quantification of Vgf- and pro-SAAS-derived peptides in endocrine tissues and the brain, and their regulation by diet and cold ... raise Vgf antibodies for ELISA assays (see Materials and Methods for more information) Decreased Vgf content In CSF and serum precedes onset of ALS-type muscle weakness assessed by rotarod-assays...
- 8
- 499
- 0
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.
... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell ... Windows NT and many Unix versions, and it can be built as an Apache module and as a binary that can run as a CGI When built as an Apache module, PHP is especially speedy A downside is that you have ... download time is faster than Java, and also you don't have to worry about integrating different languages into the page, as Curl is capable of providing the same features as both Java and JavaScript...
- 792
- 596
- 0
Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf
... greater catalytic efficiency as a reductase than as a dehydrogenase The catalytic efficiency of RDH13 as a retinaldehyde reductase is significantly lower than that of a related protein RDH11, primarily ... polyclonal antiserum against purified RDH13–His6 was raised at Alpha Diagnostics International Inc (San Antonio, TX, USA) 144 For western blot analysis of RDH13 expression, samples of human tissue obtained ... cell ratio of 10 : and incubated at 28 °C for 3–4 days The mitochondrial fraction was isolated as described above, and then solubilized with 15 mm DHPC (Avanti Polar Lipids, Alabaster, AL, USA)...
- 10
- 674
- 0
Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot
... (21 aa) and an intracellular portion (567 aa), containing a kinase homology (KH) domain, the dimerization domain and the C-terminal catalytic GC domain [1,7] In the absence of ligand, GC -A forms ... concentrations are associated with significant changes in blood pressure [6] The GC -A receptor consists of an extracellular ligand-binding domain of approximately 441 amino acids (aa), a short membrane-spanning ... analyses with antibodies against PMCA, as a marker for the cell membrane, and extracellular signalregulated kinase ⁄ (ERK1 ⁄ 2), as a marker for the cytosolic fraction, showed that cell fractionation...
- 14
- 313
- 0
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... (two-sided) Kaplan Meier analysis demonstrated that increased RBM3 mRNA levels were associated with a significantly prolonged RFS and OS (Fig 2A and 2B) Cox univariate analysis confirmed this association ... participated in the design of the study and helped draft the manuscript MAK assisted with the data collection and helped draft the manuscript IBJ assisted with the statistical analysis JM assisted ... assisted with data collection and helped to draft the manuscript JB assisted with collection of clinical data MU assisted with data collection and participated in its design FP assisted with data collection...
- 12
- 531
- 0
Báo cáo sinh học: " Codon usage in vertebrates is associated with a low risk of acquiring nonsense mutations" doc
... the analysis software; WAF and PS analyzed and interpreted the data, and wrote the manuscript Both authors read and approved the final manuscript Schmid and Flegel Journal of Translational Medicine ... mutations may have Page of advantages for organisms with relatively long lifespans and small numbers of offspring Calculating F is a novel tool for addressing codon usage bias in genes and genomes ... file 1, Table S2) F, GC content, CpG content and relative codon collection usage were calculated for the CDS Statistical analysis Results are shown as mean and standard deviation (mean ± SD)...
- 7
- 437
- 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
... Virginia Health System and office of Human Subjects Research at the NIH Information on post-operative radiation and/ or chemotherapy, and performance status of patients was unavailable for analysis ... Her2, and Her3, is a potent target for antitumor strategies as it plays a critical role in HNSCC tumor cell growth, survival, invasion, metastasis and angiogenesis Numerous pharmaceutical approaches ... Society AC: Cancer Facts and Figures 2003 Atlanta, GA 2003 Forastiere A, Koch W, Trotti A, Sidransky D: Head and neck cancer N Engl J Med 2001, 345:1890-1900 Takikita et al Journal of Translational...
- 10
- 490
- 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides ... plants CD mutations not affect RNA cis-elements Many RNA viruses contain RNA cis-elements that can affect replication To test if amino acid changes (F31 3A, F35 7A, and W405) may have inactivated ... blotted, and probed for PMV accumulation with a 32Plabelled cDNA that detects genomic (g) and subgenomic (sg) RNA Proteins were separated via SDS-PAGE and probed with rabbit polyclonal antiserum against...
- 12
- 307
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... study design was the lack of power to conduct a multi-factorial analysis that includes all the data (i.e., agonist and antagonist muscle data); therefore future studies with a larger sample size ... relating to agonist-antagonist muscle pairs A single suprathreshold pulse of Transcranial Magnetic Stimulation (TMS) over the hand area of M1 results in a balance of inhibitory and excitatory processes ... Stimulation, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA 4MIT, Boston, MA, USA 5Institut Guttmann, Universitat Autonoma de Barcelona, Barcelona, Spain 6Laboratory...
- 8
- 432
- 0
báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf
... others have shown an association with similar gait characteristics[13,17] One potential explanation may be the way the gait characteristics were measured in this study Gait variability was calculated ... associated with fall risk [1-3] The association between step width variability and fall risk has been inconsistent Gabell and Nayak suggest that step width is related to balance control and that an increase ... cardiovascular health study:design and rationale Ann Epidemiol 1991, 1:263-276 Walsh JP: GaitAnalysis: Theory and Application 1995:125-142 Blanke DJ, Hageman PA: Comparison of gait of young and...
- 8
- 402
- 0
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc
... Virginia Health System and office of Human Subjects Research at the NIH Information on post-operative radiation and/ or chemotherapy, and performance status of patients was unavailable for analysis ... Her2, and Her3, is a potent target for antitumor strategies as it plays a critical role in HNSCC tumor cell growth, survival, invasion, metastasis and angiogenesis Numerous pharmaceutical approaches ... Society AC: Cancer Facts and Figures 2003 Atlanta, GA 2003 Forastiere A, Koch W, Trotti A, Sidransky D: Head and neck cancer N Engl J Med 2001, 345:1890-1900 Takikita et al Journal of Translational...
- 10
- 479
- 0
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
... necrosis factor-related apoptosis-inducing ligand is associated with favourable ovarian cancer survival Clin Cancer Res 2003, 9:762-766 Kayagaki N, Yamaguchi N, Nakayama M, Takeda K, Akiba H, ... TRAIL, cisplatin and paclitaxelinduced cell death, cisplatin and paclitaxel being two drugs that are usually part of the initial treatment for ovarian cancer Cisplatin IC50 was increased by ascites ... proteomic analysis of ovarian cancer ascites demonstrated that malignant cells from ascites have higher levels of activated Akt and discriminated malignant ascites and poor survival outcomes [26] This...
- 10
- 383
- 0
Báo cáo hóa học: " Some fixed point-type results for a class of extended cyclic self-mappings with a more general contractive condition" pdf
... equality defining a circle Aa1 for a fixed a1 = a1 (x0, y0) ≤ a- a’ is defined below together with available point-dependent lower and upperbounds: De la Sen and Agarwal Fixed Point Theory and Applications ... 0 a (1 − α1 ) > − α1 and ® A ∪ A with >a ≥ 0, β1 = a0 a ≥ a1 ≥ a − A1 ∪ A2 a β1 = > It is noted that the condition (3.1) is not guarana0 − α1 teed to be contractive for any point of A1 It is also ... p convex Banach space (and then (X, d) is a complete metric space) and Ai and Ai+m+1 are non-empty closed subsets of X and Ai or Ai+m+1 is convex Then, (3.25) follows in the same way as Property...
- 14
- 418
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25