l4 5 loop of sivmac239 ca and q and a at the 120th and 179th positions of ca are not sufficient for hiv 2 to evade rh trim5 amp alpha mediated restriction
Báo cáo y học: "Variations in autologous neutralization and CD4 dependence of b12 resistant HIV-1 clade C env clones obtained at different time points from antiretroviral naïve Indian patients with recent infection" doc
... CCR5 3 -5. J 25 / F2 PLASMA 458 3 52 29 CCR5 3 -5. J38/F2 NARI-IVC3 PLASMA 463 3 52 31 CCR5 CCR5 4.J2/B 4 62 3 52 30 PBMC 4 62 3 52 30 CCR5 4.J27/B PLASMA 461 3 52 29 CCR5 4 -2. J41/F1 PLASMA 458 3 52 27 CCR5 ... 4.J 22/ B PLASMA 455 3 45 28 CCR5 5. J41/B 4 72 351 29 CCR5 PLASMA 461 351 26 CCR5 5- 3.J4/F1 PLASMA 4 72 351 29 CCR5 5- 3.J5/F1 PLASMA 461 3 62 30 CCR5 5- 3.J9/F1 PLASMA 4 72 351 29 CCR5 5- 4.J16/F2 PLASMA ... PLASMA 460 3 52 28 CCR5 2- 3.J18/F1 PLASMA 4 65 3 52 30 CCR5 2 -5. J3/F2 PLASMA 466 3 45 31 CCR5 2 -5. J11/F2 NARI-IVC2 PLASMA 4 65 3 52 29 CCR5 3.J16/B PBMC 466 3 52 27 CCR5 3-3.J9/F1 PLASMA 459 3 52 28 ...
- 15
- 332
- 0
Báo cáo khoa học: Sensitivity to Hsp90-targeting drugs can arise with mutation to the Hsp90 chaperone, cochaperones and plasma membrane ATP binding cassette transporters of yeast docx
... sti1DHIS3MX6 sba1DkanMX4 MATa, ura3 52 , lys2–801am, ade2–101oc, trp1-D63,his3-D200, leu2-D1 YPH500 pdr5::TRP1 YPH500 snq2::hisG YPH500 pdr5::TRP1 snq2::hisG [27 ] [27 ] [27 ] [27 ] [27 ] [27 ] [27 ] [27 ] [27 ] ... by Nathan and Lindquist as corresponding to mutant forms of Hsp90 that cause temperaturesensitive (ts) yeast growth at 37 °C [27 ] They therefore represent mutations in the Hsp 82 isoform of yeast ... protein samples; the IC50 for GA in this assay lM [8 ,23 ] the same mutant forms that are expressed in the hsp 82 mutants in Fig [ 32] There is no apparent correlation between this in vitro ATPase activity...
- 7
- 397
- 2
Arsenic speciation in environmental and biological samples extraction and stability studies
... separation and quantification and the instrumental parameters used I Pizarro et al / Analytica Chimica Acta 4 95 (20 03) 85 98 2. 2 Materials and reagents Table Instrumentation parameters HG-AFS NaBH4 ... raw material and extracts after their mineralization by FI-HG-AFS The operating parameters used are given in Table The analytical signals were evaluated as peak height, and quantification was carried ... the 88 I Pizarro et al / Analytica Chimica Acta 4 95 (20 03) 85 98 total arsenic determination and for total As species characterization and/ or validation Procedures 3.1 Mineralization for total...
- 14
- 971
- 1
Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx
... 5 -GUG GAUAUUGUUGCCAUCA-3¢ The sequences of two siRNAs for ESR1 are as follows: ERa siRNA #2 sense strand 5 -UCAUCGCAUUCC UUGCAAAdTdT-3¢, antisense strand 5 - UUUGCAAGGAAUGCGAUGAdTdT-3¢; ERa siRNA ... serve as a potential therapeutic reagent in the treatment of cancer in which ERa plays an important role Materials and methods MicroRNA -22 and estrogen receptor a RNA isolation and quantitative ... Samal E & Srivastava D (20 05) Serum response factor regulates a muscle-specific microRNA MicroRNA -22 and estrogen receptor a 23 24 25 26 27 28 29 30 31 32 33 34 35 36 that targets Hand2 during cardiogenesis...
- 11
- 237
- 0
Báo cáo khoa học: Modulation of Ca2+ entry and plasma membrane potential by human TRPM4b pptx
... 17 was achieved by fusion PCR [19] (mega-primers: 5 -TCATTAATGGGGAAGGGCCTGTCG GGACGGCGGACCCAGCCGAGAAGA-3¢ and 5 -AGG TGGTACAAACCCGGGGTCAGCCGGCAGCCCACGCC CAGGAGGAAGC-3¢) For the expression of TRPM4b ... untreated (dashed lines) (B) Quantitative analysis of the amplitude of Ca2 + released by ionomycin (left) and the amplitude of Ca2 + entry after readdition of Ca2 + (right) Values for the Ca2 + influx ... the perforated-patch configuration of the patch clamp technique [22 ,23 ] An EPC9 patch clamp amplifier was used in conjunction with the pulse stimulation and data acquisition software (HEKA Elektronik,...
- 10
- 407
- 0
Báo cáo khoa học: "Pharmacokinetics, tissue residue and plasma protein binding of ofloxacin in goats" pps
... centrifugation at 1000 g for 10 The organic and aqueous phase formed were separated by using phaseseparator filter paper After discarding the aqueous phase, the organic phase was transferred to a clean siliconized ... (0 .2 M; pH 7.4) Analytical method For quantitative determination of ofloxacin in plasma, the HPLC method of Teja-Isavadharm et al [17] was followed with some modification The analysis for ofloxacin ... ratio of 75 : 25 (v/v) The flow rate of mobile phase was 1 .2 ml/min and the eluent was monitored in Diode arry detector The chromatogram were integrated on the LC-100 laboratory computing integrator...
- 5
- 311
- 0
Báo cáo y học: " Treatment outcomes and plasma level of ritonavir-boosted lopinavir monotherapy among HIV-infected patients who had NRTI and NNRTI failure" docx
... concentration for the first 14 patients at the HIV Netherlands-Australia-Thailand Clinical Research Laboratory, which is located at the Chulalongkorn Medical Research Center (Bangkok), by high-performance ... receptor antagonist, are neither available nor affordable Nevertheless, the goal of attaining undetectable plasma HIV- 1 RNA is remain mandatory [3] To date, several clinical studies derived from the ... Treatment-Related Determinants of Patients’ Nonadherence to HIV Medications AIDS Patient Care STDS 20 09, 23 (11): 903–14 Kaplan SS and Hicks CB: Safety and antiviral activity of lopinavir/ritonavir-based...
- 5
- 302
- 0
Báo cáo y học: "Molecular characterization of hepatitis A virus isolates from environmental and clinical samples in Greece" pptx
... (isolate from sewage of Patras biological treatment plant) with the sequences of the other sewage samples from Patras (PAT74, PAT76, PAT87), the sewage sample from Alexandroupoli (ALEef) and the ... replicates Abbreviations are: PAT74, PAT76, PAT87 (sewage samples from the Patras biological treatment plant), ALEef (sewage sample from the Alexandroupolis treatment plant), KOM94-KOM89KOM64, XAN64-XAN 65 ... habitants, 80% of urban sewage samples studied showed the presence of HAV This was attributed to the fact that faecal shedding of HAV can last for months after the resolution of symptoms, and patients...
- 5
- 355
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 1 doc
... N2-tert-Butyl-N4-ethyl6-methylthio-1,3,5triazine -2, 4-diamine Vapor Pressure mPa ( 25 8 C) Kow log P ( 25 8 C) 3.8 10 2 2 .5 3 3a 35 50 2. 0 10À 4a 2. 1 171 ca 14 0. 058 a 1. 6a 1 050 a 40 0.1 65 3.1 33 50 2. 9 10À3 2. 1 6. 2a 27 –1 02 0 .2 25 3. 65 22 14 50 ... horticultural plants and trees H3C Nϩ ϩN Nϩ CH3 Paraquat ϩN Diquat Paraquat and diquat are broad spectrum herbicides absorbed by leaves, but they are not translocated in sufficient quantities to kill the ... 0. 25 1 8a 1.4 1. 1a 2. 3a 0 .2 5a 3.30 1.9 0.704 3.43 4.84 2. 75 À0.8 2. 2 60 18,000 23 ,800 14b 4 .2 145b >2 1 05 20 0b 11 21 0 .5 2 4 12 28 34 3–18 3. 8a 0.0 65 2a À0.74 2. 95 4 .2 106 25 b 10 2 20 4 20 3 .5 25 ...
- 46
- 350
- 1
Analysis of Pesticides in Food and Environmental Samples - Chapter 2 pdf
... the analytical process and need to be taken into account to guarantee the accuracy of the final result 2. 3 EXTRACTION AND PURIFICATION The main aim of any extraction process is the isolation of analytes ... switching the valve, so that the mobile phase can desorb the analytes before their separation in the chromatographic column Apart from a considerable reduction of sample manipulation, the main advantage ... injector facilitates removal of the analytes from the fiber The main advantage of the thermal desorption is the fact that the total amount of extracted analytes is introduced in the chromatographic...
- 24
- 434
- 1
Analysis of Pesticides in Food and Environmental Samples - Chapter 4 ppt
... used to generate the calibration curve, and the concentration of target analyte is calculated according to the calibration data For the 96-microwell format, it is easy to include a standard curve ... calibration standard solutions, (3) laboratory and field method blank, (4) fortified matrix samples, and (5) duplicate field samples The assay performance can be monitored by characterization of the calibration ... as to the extent of the matrix effect, the matrix may be omitted and a conversion factor applied to the buffer standard curve to account for the matrix in the sample Recently, a laboratory-based...
- 30
- 702
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 5 pdf
... replicate laboratory samples should be withdrawn or the units should be allocated randomly to replicate laboratory samples at the time of taking the primary samples In this case, the result to ... Accreditation of the laboratory by the appropriate national accreditation scheme, which itself should conform to accepted standards, indicates that the laboratory is applying sound quality assurance ... representative matrices and the typical within laboratory reproducibility coefficient of variation (CVtyp) of analysis The warning and action limits are Q Æ CVAtyp Q and Q Æ 3 CVAtyp Q, respectively At...
- 26
- 467
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 8 pdf
... CARBAMATES Typical characteristics of carbamate insecticides are their high polarity and solubility in water and their thermal instability Methods based on the derivatization of carbamates to thermally ... Pesticides and their degradation or transformation products may cause toxic effects to man and the environment, making necessary to evaluate if their application may cause an unacceptable risk Consequently, ... carbamates that has gone through a postcolumn derivatization process The preparation of thermally stable derivatives for the subsequent gas chromatographic analysis is an alternative that nowadays is...
- 24
- 388
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 9 doc
... [64] compared ELISA data from a surface water reconnaissance to GC data on cyanazine and metolachlor A total of 53 5 surface water samples from locations in Mississippi, Louisiana, Arkansas, and Tennessee ... great advantage for easier transportation between laboratories or from the field to the laboratory, and for easier storage For example, water samples can be processed at a remote site, and only the ... the automation of both plate and tube assays Great efforts have been made to achieve the miniaturization and automation of immunoassay techniques Also, an important premise in ELISA kits is their...
- 26
- 416
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 10 pdf
... injector and detector was maintained at 25 0 8C Because of the fluctuating sensitivity of the detector, quantification of pesticides extracted by C18 cartridges was carried out by the internal standard ... hexane, and 50 =50 hexane=acetone prior to sampling Some authors (i.e., Coupe et al .21 ) used a heater to clean filters (backing at 450 8C for example) In all cases, a blank analysis is required to ... measuring the post-application volatilisation of pesticides Water Air Soil Pollut., 1 15, 83, 1999 59 Cessna, A. J and Kerr, L .A Use of an automated thermal desorption system for gas chromatographic...
- 30
- 517
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 11 pot
... Head cabbage Leek Lettuce Lettuce Peas Peas Peppers Tomatoes Tomatoes 20 04 20 01 20 02 2003 20 01 20 02 20 02 2004 20 01 20 03 20 00 20 04 20 04 20 04 20 01 20 03 20 00 20 03 20 04 20 01 3133 26 41 883 21 63 1 721 ... cucumber, potato, apple, grape, and orange The most frequent findings were dithiocarbamates in 73% of the tomatoes, 80% of the eggplants and cucumbers, and 50 % of the apples and grapes The concentrations ... Europe No data were found either from South America, Africa, or Australia Data from Asia are from the two biggest nations, India and China, and cover therefore the majority of the population of this...
- 32
- 555
- 0
Analysis of Pesticides in Food and Environmental Samples - Chapter 12 (end) potx
... and analysis The quality of the data generated from any monitoring program is defined by two key factors: the integrity of the sample and the limitations of the analytical methodology The QA=QC ... PNEC value can be calculated as TABLE 12. 1 Assessment Factors to Derive a PNECaquatic Available Data Assessment Factor At least one short-term L(E)C50 from each of three trophic levels of the base ... that aids understanding of the spatial and temporal patterns, ß 20 07 by Taylor & Francis Group, LLC taking into consideration the characteristics of the study areas, and that allows the human...
- 40
- 403
- 0
báo cáo khoa học: " LysoPC acyltransferase/PC transacylase activities in plant plasma membrane and plasma membrane-associated endoplasmic reticulum" ppt
... between the sn-1 (diagonally hatched bar) and sn -2 (cross-hatched bar) positions of [14C]PC The data represent the mean values and range from duplicates eral roles: (i) to adjust the acylation pattern ... 13 53 A pea shoot plasma membrane fraction was the starting material for the isolation of the PAM fraction The PAM-decreased plasma membrane fraction represents the plasma membranes obtained after ... a transacylase activity It has been demonstrated that PC and PE acylated with C16/C18 fatty acids are delivered to the plasma membrane independently of the vesicular secretory pathway [8,9] As...
- 12
- 230
- 0
Báo cáo khoa học: " Mass transfer, clearance and plasma concentration of procalcitonin during continuous venovenous hemofiltration in patients with septic shock and acute oliguric renal failure" ppsx
... Qi – Quf Statistical analysis Results are presented as the mean ± standard deviation Comparisons of measured and calculated data were performed using analysis of variance or the Mann–Witney and ... significantly increased while the plasma clearance remained stable and the adsorbed mass/total inlet mass ratio significantly decreased This relation between the ultrafiltration rate and the plasma ... 12, 300 Da) on the AN69 membrane is maximal at pH 7.4 and linearly increases with the wall shear rate and the electrical differential potential [19] The cut-off of 35 40 kDa allows the filtration...
- 7
- 217
- 0
Investigation and application of liquid chromatography mass spectrometry in the analysis of polar, less volatile and thermal unstable organic pollutants in environmental and biological samples 6
... behavior of N-methylcarbamate in environmental water samples Propoxur was selected as a model compound to study the degradation behavior in ultrapure water, drinking water, rain water, river water and ... N-methylcarbamate and related compounds (propoxur and its metabolisms as model compounds) in biological materials (goldfish, tortoises and sea lettuce) Orthogonal array design with an OA8 (27 ) matrix ... thermal degradation under the extraction conditions The results indicate that although carbamates tested in this study are thermally labile, there was little observable degradation under the optimum...
- 3
- 291
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25