khi thay động cơ 1 bằng động cơ mới thì phải đảm bảo các yêu cầu sau

INVESTIGATION OF THE FUNCTIONS OF p23 AND COAT PROTEIN OF HIBISCUS CHLOROTIC RINGSPOT VIRU

... extraction Table 2 .1 CTAB extraction buffer Component 10 % PEG 8000 1M Tris-Cl PH7.0 5M NaCl 10 % CTAB 500mM EDTA 10 % sodium lauryl sarcosine ddH O Volume Con 10 ml (1% ) 10 ml (0 .1 M) 28 ml (1. 4 M) 20 ml ... upregulates AGO1 by regulating SO overexpression AGO1 feedback regulates plant conserved miRNAs, including miR165, miR167 and miR1 71 Downregulation of AGO1 and scarecrow-like protein (SCL1) by miR168 and ... 17 2.3.9 Electro-transformation for Agrobacterium 17 2.3 .10 Agrobacterium-infiltration 17 2.3 .11 TaqMan two-step RT-PCR 18 2.4 Analysis of DNA 19 2.4 .1 Plant...

223
1,525
0

báo cáo khoa học: " Profiling microRNA expression in Arabidopsis pollen using microRNA array and real-time PCR" pps

Danh mục: Báo cáo khoa học

... 15 9b -0. 31 1.04 -3. 31 -3. 01 NA 24.3 10 18 9644 5 319 15 9c -0 .17 1. 07 -2.87 -2.84 35.85 29.7 4.49 35850 12 47 16 0a-c -0.04 0.39 -0. 31 -0.39 30. 71 28.95 0.74 17 833 3 51 1 61 -0.03 1. 04 -1. 29 -1. 36 33.65 ... 37.04 26 .1 10.03 10 005 349 16 5a,b 0. 31 0.58 0.06 1 15 16 6a-g -0.24 1. 11 -3.04 -3.25 31. 93 24.9 6.4 472 33 16 7a,b -0.64 0.96 -2.4 -2.29 35.95 25.6 9.48 218 336 81 115 4 16 7c -0.34 0.94 -1. 41 -1. 55 NA ... -1. 04 34.42 31. 18 2.26 17 92 6 71 158a 0.07 0.77 -2. 21 -2 .12 32.87 27.9 3.95 16 305 2307 15 8b 0 .15 0.79 -1. 82 -1. 82 32.89 30.5 1. 39 13 757 2037 15 9a -0.33 1. 03 -3 .17 -3.04 NA 25.2 67 19 7957 5540 15 9b...

10
324
0

Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

Danh mục: Báo cáo khoa học

... 6: 217 http://www.virologyj.com/content/6 /1/ 217 References 10 11 12 13 14 15 16 17 18 19 20 21 22 Rossmann MG, He Y, Kuhn RJ: Picornavirus-receptor interactions Trends Microbiol 2002, 10 :324-3 31 ... types of integrins [7 -10 ], intracellular adhesion molecule (ICAM -1) [11 ,12 ], decay-accelerating factor (DAF or CD55) [13 ,14 ] and coxsackie- and adenovirus receptor (CAR) [15 ,16 ] Group B coxsackieviruses ... http://www.virologyj.com/content/6 /1/ 217 tained in DMEM (Sigma), supplemented with 10 % newborn calf serum (NCS) (Biological Industries) and 1% penicillin-streptomycin and L-glutamine (Sigma) 1mg/ ml G 418 (Sigma) was...

6
230
0

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Danh mục: Hóa học - Dầu khí

... 0.96 1. 09 0.93 1. 23 1. 83 1. 30 1. 02 0.94 12 .22 HFF 1. 56 1. 09 1. 12 1. 34 1. 45 1. 75 1. 94 1. 87 1. 70 1. 54 15 .36 HFF 0.65 0.58 0.60 0.60 0.82 0.60 1. 14 0.58 0.74 0.63 6.8 HFF 0.86 0. 61 0.75 0.76 0. 71 0.90 ... HSV1NC1 HSV1NC1 VZVSchen MDDC HELA 0.98 0.84 0.78 0.53 1. 04 0.75 1. 26 0.88 0.83 0.60 0.84 0.84 0.98 0.93 1. 09 0.78 1. 45 0.90 0.97 0.72 10 .22 7.77 HUT78 1. 11 1 .18 1. 34 0.96 1. 35 1. 13 2.20 1. 20 1. 38 ... 1. 20 1. 38 1. 05 12 .90 HUT78 1. 21 0.64 0.83 0.90 0.99 1. 17 1. 53 0.87 0.97 1. 16 10 .27 HELA 0.80 0.65 1. 33 0.62 0. 91 0.59 0.89 0.60 0.92 0.74 8.05 HEP2 0. 41 0.42 0.44 0.50 0.37 0.38 0.60 0. 41 0.57 0.54...

5
481
0

Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

Danh mục: Điện - Điện tử

... 1. 57 0.70 1. 30 1. 38 0.95 1. 66 0.89 1. 31 1.37 1. 08 1. 40 0.84 1. 39 4.79 1. 15 2.04 1. 04 1. 31 1.54 0.96 1. 92 0.80 1. 48 20.09 13 .27 18 .95 9.73 17 .34 sumV 8. 41 14.20 6 .11 8.05 7.03 6.29 6 .19 6.08 10 .33 ... β2M L13 PLA TBP GAP PPI G6P Tub sumRGC CMV HHV-6 CAMP SARS YF 1. 41 2.82 1. 70 0.83 1. 65 3. 41 1.38 3.84 1. 88 3.69 1. 42 1. 15 1. 40 0.82 1. 32 1. 63 1. 55 1. 94 1. 06 1. 87 1. 45 1. 19 1. 49 0.87 2.02 1. 69 1. 03 ... 0.88 1. 23 1. 11 4.24 2.90 2.27 3 .19 2.75 6.35 2.54 1. 25 1. 78 1. 34 3 .14 12 . 51 3.35 2.22 4 .14 5.42 2.39 2.30 3.33 1. 78 7.48 45.49 30.78 39.33 20.58 68 .17 sumV 21. 87 45.23 18 .22 13 .07 23.78 9.82 17 .45...

5
452
0

Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx

Danh mục: Điện - Điện tử

... (0.34 – 3 .18 ) 1. 86 (0.84 – 4 .13 ) 1. 1 (0.44 – 2.74) 1. 08 (0.60 – 1. 95) 2.05 (1. 15 – 3.64) 1. 53 (0.82 – 2.87) 0. 71 (0.37 – 1. 35) 1. 13 (0.45 – 2.80) 0.68 0 .19 0.83 1. 00 0 .14 0.44 0.40 0.86 * Comparison ... Seroprevalence and incidence of sex- Page of 10 (page number not for citation purposes) Virology Journal 2005, 2: 61 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 ually transmitted diseases in ... [EMBL:X0 318 1 .1] , [EMBL:X04495 .1] , [EMBL:X047 71. 1], [EMBL:X1 411 2 .1] , [DDBJ:AB072389 .1] , [DDBJ:AB070847.2], [Gen[DDBJ:AB070848.2], Bank:M10792 .1] and HSV-2 [GenBank:AY038367 .1] , [GenBank:M14793 .1] , [Gen[EMBL:Z86099.2],...

10
458
0

Báo cáo sinh học: " Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" pptx

Danh mục: Điện - Điện tử

... Stroke (S 11 NS0 418 33 and U54 039406), and from the National Center for Research Resources (G12 RR0030 61 and P20 RR 018 727), National Institutes of Health References 10 11 12 Competing interests 13 The ... Virology Journal 2006, 3:3 16 17 18 19 20 21 22 23 24 25 26 http://www.virologyj.com/content/3 /1/ 3 sequences in urine and cerebrospinal fluid J Virol Methods 2004, 12 1: 217 -2 21 Whiley DM, Mackay IM, ... (Fig 1B) The intra-run Page of (page number not for citation purposes) Virology Journal 2006, 3:3 http://www.virologyj.com/content/3 /1/ 3 3000 A 2000 15 00 10 1f g fg 0f g 10 500 1p g pg 10 00 10 ...

5
358
0

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Danh mục: Hóa học - Dầu khí

... 0.96 1. 09 0.93 1. 23 1. 83 1. 30 1. 02 0.94 12 .22 HFF 1. 56 1. 09 1. 12 1. 34 1. 45 1. 75 1. 94 1. 87 1. 70 1. 54 15 .36 HFF 0.65 0.58 0.60 0.60 0.82 0.60 1. 14 0.58 0.74 0.63 6.8 HFF 0.86 0. 61 0.75 0.76 0. 71 0.90 ... HSV1NC1 HSV1NC1 VZVSchen MDDC HELA 0.98 0.84 0.78 0.53 1. 04 0.75 1. 26 0.88 0.83 0.60 0.84 0.84 0.98 0.93 1. 09 0.78 1. 45 0.90 0.97 0.72 10 .22 7.77 HUT78 1. 11 1 .18 1. 34 0.96 1. 35 1. 13 2.20 1. 20 1. 38 ... 1. 20 1. 38 1. 05 12 .90 HUT78 1. 21 0.64 0.83 0.90 0.99 1. 17 1. 53 0.87 0.97 1. 16 10 .27 HELA 0.80 0.65 1. 33 0.62 0. 91 0.59 0.89 0.60 0.92 0.74 8.05 HEP2 0. 41 0.42 0.44 0.50 0.37 0.38 0.60 0. 41 0.57 0.54...

5
574
0

báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

Danh mục: Hóa học - Dầu khí

... 1. 57 0.70 1. 30 1. 38 0.95 1. 66 0.89 1. 31 1.37 1. 08 1. 40 0.84 1. 39 4.79 1. 15 2.04 1. 04 1. 31 1.54 0.96 1. 92 0.80 1. 48 20.09 13 .27 18 .95 9.73 17 .34 sumV 8. 41 14.20 6 .11 8.05 7.03 6.29 6 .19 6.08 10 .33 ... β2M L13 PLA TBP GAP PPI G6P Tub sumRGC CMV HHV-6 CAMP SARS YF 1. 41 2.82 1. 70 0.83 1. 65 3. 41 1.38 3.84 1. 88 3.69 1. 42 1. 15 1. 40 0.82 1. 32 1. 63 1. 55 1. 94 1. 06 1. 87 1. 45 1. 19 1. 49 0.87 2.02 1. 69 1. 03 ... 0.88 1. 23 1. 11 4.24 2.90 2.27 3 .19 2.75 6.35 2.54 1. 25 1. 78 1. 34 3 .14 12 . 51 3.35 2.22 4 .14 5.42 2.39 2.30 3.33 1. 78 7.48 45.49 30.78 39.33 20.58 68 .17 sumV 21. 87 45.23 18 .22 13 .07 23.78 9.82 17 .45...

5
539
0

báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf

Danh mục: Hóa học - Dầu khí

... (0.34 – 3 .18 ) 1. 86 (0.84 – 4 .13 ) 1. 1 (0.44 – 2.74) 1. 08 (0.60 – 1. 95) 2.05 (1. 15 – 3.64) 1. 53 (0.82 – 2.87) 0. 71 (0.37 – 1. 35) 1. 13 (0.45 – 2.80) 0.68 0 .19 0.83 1. 00 0 .14 0.44 0.40 0.86 * Comparison ... Seroprevalence and incidence of sex- Page of 10 (page number not for citation purposes) Virology Journal 2005, 2: 61 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 ually transmitted diseases in ... [EMBL:X0 318 1 .1] , [EMBL:X04495 .1] , [EMBL:X047 71. 1], [EMBL:X1 411 2 .1] , [DDBJ:AB072389 .1] , [DDBJ:AB070847.2], [Gen[DDBJ:AB070848.2], Bank:M10792 .1] and HSV-2 [GenBank:AY038367 .1] , [GenBank:M14793 .1] , [Gen[EMBL:Z86099.2],...

10
440
0

báo cáo hóa học:"Comparison of real-time PCR and hemagglutination assay for quantitation of human polyomavirus JC" potx

Danh mục: Hóa học - Dầu khí

... Stroke (S 11 NS0 418 33 and U54 039406), and from the National Center for Research Resources (G12 RR0030 61 and P20 RR 018 727), National Institutes of Health References 10 11 12 Competing interests 13 The ... Virology Journal 2006, 3:3 16 17 18 19 20 21 22 23 24 25 26 http://www.virologyj.com/content/3 /1/ 3 sequences in urine and cerebrospinal fluid J Virol Methods 2004, 12 1: 217 -2 21 Whiley DM, Mackay IM, ... (Fig 1B) The intra-run Page of (page number not for citation purposes) Virology Journal 2006, 3:3 http://www.virologyj.com/content/3 /1/ 3 3000 A 2000 15 00 10 1f g fg 0f g 10 500 1p g pg 10 00 10 ...

5
327
0

Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps

Danh mục: Báo cáo khoa học

... 50 11 7 11 1 5 1 50 11 7 11 1 5 1 50 0 0 0 0 0 0 10 0 0 0 0 0 ATCC 43890 ATCC 12 795 ATCC 33780 c NCTC 90 01 ATCC 9 610 ATCC 25923 ATCC 29 213 ATCC 19 117 ATCC 33090 ATCC 19 119 ATCC 13 124 ATCC 6939 ... (%) Salmonella Salmonella Salmonella spp Typhimurium Enteritidis 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 99 .1 91. 7 98.4 91. 7 10 0 10 0 99 .1 0 0.9 0 8.3 Our results indicated that the multiplex real-time ... 2.66 ± 0.05 1. 65 ± 0.07 0.65 ± 0.07 JOE Post-enrichment Cy5 FAM JOE Cy5 󰠏‡ 14 .47 20.23 󰠏 26.99 31. 91 󰠏 32.23 36.94 14 .52 20. 31 󰠏 󰠏 35.32 37.83 16 .00 21. 40 󰠏 19 .83 󰠏 󰠏 32.06 29.95 17 . 01 21. 27 󰠏 󰠏...

9
410
0

Báo cáo khoa học: "Real time PCR analyses of expression of E-cadherin, alpha-, beta- and gamma-catenin in human breast cancer for predicting clinical outcome" pps

Danh mục: Báo cáo khoa học

... Pathol 19 94, 17 4 :10 1 -10 9 Page of (page number not for citation purposes) World Journal of Surgical Oncology 2008, 6:56 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Pierceall WE, ... (HECD -1, mouse IgG1 1: 50, R&D systems, Oxon, UK), anti-α-catenin (rabbit IgG1 1: 50 dilution; Sigma), anti-β-catenin (mouse IgG1 1: 100, R&D systems, Oxon, UK) and anti-γ-catenin (mouse IgG1 1: 100, ... background 16 9.6 ± 5.83, tumour 82.7 ± 12 .78 p < 0.0 01; α-catenin normal background 16 3.22 ± 4.27, tumour 92.22 ± 21. 02 p < 0.0 01, β-catenin normal background 216 .1 ± 15 .94, tumour 99 ± 32.93 p < 0.0 01, ...

6
303
0

Báo cáo y học: " “pp65 antigenemia and real time polymerase chain reaction (PCR) based-study to determine the prevalence of human cytomegalovirus (HCMV) in kidney donors and recipients with follow-up studies.”" pptx

Danh mục: Báo cáo khoa học

... × 10 5 leucocytes HCMV DNA detected copy/ ml 692 20 775 86 8462847 78 3 817 13 15 386 25 202 01 28 18 51 35 647 25 724 10 14 16 73 11 32 29768 12 38 75479 13 35 500 14 48 460 15 78 2 71 16 20 775 17 ... D-/PRR-/PSR+ 26/26 15 $/26 Sub-Group I Sub-Group III *D+/PRR+/PSR+ 1/ 1 0 /1 Sub-Group IV *D+/PRR-/PSR- 2/2 0/2 Sub-Group V D-/PRR-/PSR- 0/7 0/7 # /18 2 /18 1/ 18 0 /18 PSR+ 19 ^ /19 19 /19 D+ Group C D-/PRR-/PSR+ ... 78 2 71 16 20 775 17 86 8462847 18 78 3 817 19 230 30902 20 692 21 49 674 22 35 4849 23 47 24 27 337 25 334 26 22 7456 27 15 14 11 28 40 2 410 4 29 52 6756 30 20 2265 31 4937 32 3079 33 32 29768 pp65...

7
399
0

Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc

Danh mục: Báo cáo khoa học

... × 10 8 6.0 × 10 6 4 17 .67 24.38 0.38 0.53 2 .15 2 .17 Within 6.0 × 10 4 30.23 0.44 1. 46 Within 6.0 × 10 2 37 .18 0.36 0.97 Among 6.0 × 10 8 17 .35 0.04 21 Among 6.0 × 10 6 24.30 0 .14 57 Among 6.0 × 10 4 ... 2006, 13 4:257-260 10 Astell CR, Thomson M, Chow MB, Ward DC: Structure and replication of minute virus of mouse DNA Cold Spring Harb Sym Quant Biol 19 83, 47:7 51- 762 doi :10 .11 86 /17 43-422X-7-353 ... 6.0 × 10 4 30.83 0 .14 46 Among 6.0 × 10 2 37.80 0 .16 42 Song et al Virology Journal 2 010 , 7:353 http://www.virologyj.com/content/7 /1/ 353 Page of Table Detection of PRRSV in 41 clinical samples...

4
587
0

báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt

Danh mục: Báo cáo khoa học

... [http://www.biomedcentral.com/content/supplementary /14 712 229-9-84-S2.jpeg] 10 11 12 13 14 15 16 17 18 19 20 Acknowledgements This work was funded by grants from CNPq and CBAB and a Ph.D fellowship from CAPES, Brazil 21 Keller-Grein ... (86%) 1. 00 0.008 GE 617 476 BbrizTUB putative tubulin alpha-5 chain 4e- 51/ 96/98 (97%) 1. 01 0. 019 GE 617 477 BbrizUBCE1 Ubiquitin-conjugating enzyme BbrizUBCE2 4e- 31/ 64/74 (86%) 0.92 0. 013 0.95 ... Accession Number BbrizEF1 Elongation factor -1 alpha 4e-89/ 16 6 /17 9 (92%) 0.87 0. 012 EZ000623 BbrizEIF4A Eukaryotic initiation factor 4A 4e- 41/ 88 /10 0 (88%) 0.94 0. 011 EZ000622 BbrizGAPDH glucose-6-phosphate...

10
267
0

báo cáo khoa học: " Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida" pot

Danh mục: Báo cáo khoa học

... geNorm EF1a (0.05) RPS13 (0.05) SAND (0 .14 ) UBQ (0 .14 ) EF1a (0 .13 ) RPS13 (0 .13 ) RAN1 (0.08) RPS13 (0.08) RAN1 (0.47) SAND (0.47) EF1a (0 .11 ) RPS13 (0 .11 ) RAN1 (0 .14 ) SAND (0 .14 ) EF1a (0.37) RPS13 (0.37) ... (0 .15 ) RPS13 (0.07) CYP (0.25) CYP (0.09) SAND (0 .11 ) EF1a (0.05) TUB (0 .14 ) EF1a (0.25) SAND (0.28) RPS13 (0 .14 ) RAN1 (0 .18 ) SAND (0 .12 ) RAN1 (0 .18 ) RAN1 (0.20) EF1a (0. 21) (0 .10 ) (0 .13 ) (0 .12 ) ... TGGAAACTCAACCTCCATCCA/ TTTCGTCCATTCCTTCACCTG 13 5 1. 83 ± 0.09 11 4 1. 70 ± 0.04 10 3 1. 71 ± 0.07 13 5 1. 61 ± 0 .12 11 4 1. 61 ± 0.05 TGGAGGATGGAAGGACTTTGG/ CAGGACGACAACAAGCAACAG 15 3 1. 67 ± 0.02 GAPDH Glyceraldehyde-3-phosphate...

11
330
0

Báo cáo y học: " Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR" pot

Danh mục: Báo cáo khoa học

... HPV16 L1 X 10 e2 HPV16 L1 X 10 e1 HPV16 L1 X 10 e6 HPV 11 L1 X 10 e5 HPV 11 L1 X 10 e4 HPV 11 L1 X 10 e3 HPV 11 L1 X 10 e2 HPV 11 L1 X 10 e1 HPV 11 L1 HPV16 L1 (FAM) HPV18 L1 (Hex) 2.00E+06 HPV L1 copy # 2.00E+05 ... HPV 11 L1 (Texas Red) HPV6 L1 (Cy5) X 10 e6 HPV18 L1 X 10 e5 HPV18 L1 X 10 e4 HPV18 L1 X 10 e3 HPV18 L1 X 10 e2 HPV18 L1 X 10 e1 HPV18 L1 X 10 e6 HPV16 L1 X 10 e5 HPV16 L1 X 10 e4 HPV16 L1 X 10 e3 HPV16 L1 ... Journal 2 010 , 7 :19 4 http://www.virologyj.com/content/7 /1/ 194 Page of 17 A HPV6 L1 HPV 11 L1 HPV16 L1 HPV18 L1 B X 10 e4 HPV6 ,11 ,16 ,18 L1 X 10 e4 HPV6 ,11 ,16 ,18 L1 X 10 e4 HPV11L1 X 10 e4 HPV6 L1 HPV6 L1 (Cy5)...

17
413
0

Báo cáo khoa học: " Establishment of one-step SYBR green-based real time-PCR assay for rapid detection and quantification of chikungunya virus infection" pps

Danh mục: Báo cáo khoa học

... 10 -1 105 10 4 9 .11 13 .75 Positive Positive Diluted 10 -2 10 3 17 .89 Positive -3 10 2 22.00 Positive Diluted 10 -4 10 1 26.45 Positive Diluted 10 -5 10 0 28.64 Positive Ross River virus (Alphavirus) 10 4 ... concentrations (10 0 to 10 5 PFU/ml) using the nsP2 primer set Ho et al Virology Journal 2 010 , 7 :13 http://www.virologyj.com/content/7 /1/ 13 Page of 10 5 PFU/ml 10 4 PFU/ml 10 3 PFU/ml 10 2 PFU/ml 10 1 PFU/ml 10 0 ... synergistic effect of interferon-alpha and ribavirin combination Antiviral Res 2004, 61( 2) :11 1 -11 7 doi :10 .11 86 /17 43-422X-7 -13 Cite this article as: Ho et al.: Establishment of one-step SYBR greenbased...

7
262
0

Báo cáo khoa học: "Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe" pps

Danh mục: Báo cáo khoa học

... 0 .11 7. 71 ± 0 .12 8 .13 ± 0.02 8.72 ± 0 .13 8.4 ± 0 .19 8 .14 ± 0 .16 8.02 ± 0.05 7.97 ± 0.04 8.75 ± 0.20 7.94 ± 0 .11 8.32 ± 0 .16 8.00 ± 0 .11 7.95 ± 0.09 8.23 ± 0 .10 8. 41 ± 0 .19 1d Table Mean AHV -1 ... 29.63 0. 21 0.70 1. 00E+04 33.07 0. 31 0.92 1. 00E+03 36.33 0. 31 0.84 1. 00E+02 39.50 0 .17 0.44 1. 00E+ 01 42.67 0.32 0.75 1. 00E+08 19 .70 0.28 1. 41 1.00E+07 1. 00E+06 23.09 26. 31 0.47 0.32 2.03 1. 23 1. 00E+05 ... 7.33 ± 0 .19 6.78 ± 0.05 7.70 ± 0 .18 6.64 ± 0 .11 7. 61 ± 0 .19 7 .14 ± 0 .18 7.23 ± 0 .12 7.24 ± 0.07 7.76 ± 0 .14 7.39 ± 0 .15 7.84 ± 0.08 7 .11 ± 0 .15 7.30 ± 0 .16 6.84 ± 0.06 7.53 ± 0 .12 7.29 ± 0 .11 7.87...

10
293
0