influence of riblets on a boundary layer with görtler like vortices
Báo cáo khoa học: "Influence of support on intra-abdominal pressure, hepatic kinetics of indocyanine green and extravascular lung water during prone positioning in patients with ARDS: a randomized crossover study" pot
... (%) ASAT, aspartate aminotransferase; ALAT, alanine aminotransferase For bilirubin and prothrombin, data are expressed as mean ± SD For transaminases and creatinine, data are expressed as median ... principal investigators and led the conceptual design of the design and the manuscript preparation MG made contributions to the acquisition of data and to the analysis and interpretation of data JMS, ... by ANOVA) without any influence of the kind of support Effects of prone position and support on hemodynamic and respiratory parameters (Table 2) ANOVA showed that CVP, mean pulmonary arterial...
- 7
- 469
- 0
Báo cáo hóa học: " On a boundary value problem of a class of generalized linear discrete-time systems" ppt
... solution of the equation k (AQp + BQp JpN −k0 )C = D Other type of boundary conditions Assume that the matrix difference equation (1) has a different type of boundary conditions Let the boundary conditions ... linear matrix differential equations for consistent and nonconsistent initial conditions: regular case ISRN Math Anal 2011 14 (2011) Article ID 183795 Kalogeropoulos, GI, Psarrakos, P: A note on ... Jordan canonical form of regular matrix polynomials Linear Algebra Appl 385, 117–130 (2004) doi:10.1186/1687-1847-2011-51 Cite this article as: Dassios: On a boundary value problem of a class of generalized...
- 9
- 388
- 0
báo cáo hóa học:" Research Article A Note on a Beam Equation with Nonlinear Boundary Conditions" doc
... function of t, thus M a, b b t∈ a, b b k t, s ds a b k a, s ds a a a a2 − 3s2 3.3 6s ds Since k is a nondecreasing function of t, we have max 0
- 14
- 276
- 0
Báo cáo khoa học: "The influence of fire on the seed bank in the soil of a Quercus faginea forest (NW Spain)" pot
... percentage of sand, slime and clay and a lack of organic material The fact that it has a very compact upper limestone layer means that soil humidity is greater, favouring gall oak development This area ... surrounding Palencia and is of ecological importance as it is a conjunction of a basophyle holm oak (Quercus rotundifolia) stand in a mesophyte fasciation with many gall oaks, in this studied area Quercus ... that time This has had an influence on the accumulation of fuel, and consequently caused a growing risk of fires For historic reasons this area is an island of forest vegetation in the area surrounding...
- 10
- 314
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... inter-language study and a central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular ... Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives A contrastive analysis with their Vietnamese equivalents (Graduation paper submitted ... non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class of words which can be graded,...
- 44
- 1,747
- 7
Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx
... your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems System Services Development Tools Data Access Data Storage ... responses with the class The instructor will write the class consensus on a flip chart Use the space below for brainstorming Activity 7.2: Determining the Impact of Technology on a Windows DNA ... Activity 7.2: Determining the Impact of Technology on a Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned...
- 4
- 631
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...
- 14
- 517
- 0
Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf
... reagent (Invitrogen) and purified with an RNAeasy column (Qiagen) RNA quality was assessed with a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) Homemade cDNA microarrays containing ... Hybridization was performed with each individual sample and the common labeled reference sample After being washed, the microarray slides were scanned with an Agilent microarray scanner Data analysis ... effects on rat liver gene expression A a b c d e f g h B Fig (A) Box-plot presentation of gene expression regulation Gene expression regulation was determined with the microarray data and compared with...
- 9
- 506
- 0
influence of binders on the sensing and electrical characteristics of wo3-based gas sensors
... radicals Although an actual WO polycrystal has a random GB potential barrier network, suppose that it has a planar type interface for the simplicity of discussion As a result of gas adsorption ... of this non-intimate contact varies according to the species and the amount of adsorbed atoms w14x This fact means that the potential barrier height of the GB of a given material may depend on ... the distribution of interface states and the electron occupation on them In some cases, even the concentration of the adsorbed gas ions can be measured from the change of potential barrier w15x...
- 7
- 634
- 0
Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx
... Resnikoff, Howard preparation The Illusion of Reality, 1985, in Waltz, David L and Jordan B Pollack "Massively Parallel Parsing: A Strongly Interactive Model of Natural Language Interpretation," ... is similar in function to a serial sort It accepts as arguments a parallel data field and a parallel comparison predicate, and it sorts among the selected processors so that the data in each successive ... f.DEFINITION = y DEFINITION When combined with an appropriate F, scan has applications in a variety of contexts For example, scan is useful in the parallel enumeration of objects and for region labeling•...
- 8
- 306
- 0
Đề tài " Formation of singularities for a transport equation with nonlocal velocity " potx
... ill-posed for general initial data A linear analysis of small perturbations of planar sheets leads to catastrophically growing dispersion relations Several attempts at regularization were introduced ... results for a one-dimensional transport equation with nonlocal flux, Comm Appl Anal (1997), 315–336 [12] T Sakajo, On global solutions for the Constantin-Lax-Majda equation with a generalized viscosity ... Annals of Mathematics, 162 (2005), 1377–1389 Formation of singularities for a transport equation with nonlocal velocity ´ ´ By Antonio Cordoba∗ , Diego Cordoba∗∗ , and Marco A Fontelos∗∗ * Abstract...
- 14
- 252
- 0
influence of parents on thier childrens sexual orientation
... children of gay or lesbian families She also found, as others have, that many children of gay and lesbian families, many of the children identify themselves as heterosexual She also found that that ... that sexual orientation was unrelated to the amount of time the children spent living with their homosexual parents, a result that would seem to be at odds with many versions of environmental theories ... theories about the transmission of sexual orientation (Patterson 5-6) Due to incomplete research an answer is still unknown to why children become homosexual It is known that the influence of parents...
- 2
- 306
- 0
Báo cáo hóa học: " An exploratory investigation of the influence of publication on translational medicine research" pot
... medicine pathway The journals chosen appeared to publish work which is at particular stages along the translational pathway To evaluate the progress of an intervention along the translational pathway ... reader and the author along the translational medicine pathway Even in this small sample of journals the positioning of the journal in the translational pathway is likely to affect the chance of an ... proof of efficacy for an intervention (where proof of concept has already been achieved), to the point where, in Managed Translational Pathway Preclinical Phase Phase I Phase II Phase III Phase...
- 5
- 344
- 0
báo cáo hóa học: " Differential aspects of stroke and congestive heart failure in quality of life reduction: a case series with three comparison groups" pot
... the Brazilian National Research Committee (CNPq) Author details Stroke Clinic of the Federal University of Bahia, Ambulatório Magalhães Neto, Rua Padre Feijó 240 Canela, Bahia, Brazil 2Bahiana School ... Authors’ contributions EBP conceived and carried out the study, and participated in the data analysis, drafting IM participated in the acquisition of data for EQ-5D and mBI, and database management ... participated in the acquisition of data for NIHSS and mBI, and database management TGF, JCS, DFM, CC, ISN participated in the acquisition of data for NIHSS and mBI PAPJ participated in the acquisition...
- 5
- 359
- 0
Báo cáo hóa học: " Morphology-Controllable Synthesis of CeO2 on a Pt Electrode" pptx
... (Japan) using a Cu Ka X-ray source operating at 45 kV and 100 mA, scanning at the rate of 4°/min with an angular resolution of 0.05° of the 2h scan to get the Fig FESEM images of psCeO2 prepared ... lengths of anodic oxidation As seen, only a few of nanoparticles with size of 15–50 nm (measured from the SEM micrograph and consistent with the crystallite size calculated from XRD) are present on ... are constituted by the oriented aggregation of small CeO2 nanoparticles The diameter of the CeO2 nanoparticles is in the range of 20– 100 nm calculated by statistical software with the FESEM With...
- 4
- 320
- 0
Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx
... Japan Cover glass was purchased from Matsunami Glass Ind., Ltd., Japan A photoresist (OFPR-800) was purchased from Tokyo Ohka Kogyo Co., Ltd., Japan CNT immobilization on glass Fabrication of ... over that of using a single layer of APS After deposition of the source and drain electrodes, the top gate was fabricated on a 500-nm-thick APS layer on nanotubes and source and drain electrodes ... CNTs are immobilized specifically on a bare substrate and the ODT layer is used as a non-binding area One attendant problem might be immobilization of biomolecules on the CNT-FET For immobilization...
- 6
- 346
- 0
Báo cáo hóa học: " Research Article Statistical Segmentation of Regions of Interest on a Mammographic Image" doc
... D Yamazaki, H Hara, T Iwase, and T Endo, “An automated classification method for mammograms based on evaluation of fibroglandular breast tissue density,” in Proceedings of the 5th International ... radiologist’s manual segmentation; (c) obtained segmentation with initialization INIT A and SA algorithm (78 iterations); (d) obtained segmentation compared to radiologist’s manual segmentation ... statistical grey-level histogram modeling and classification based on multiresolution histogram information, respectively This paper deals with Bayesian segmentation of breast anatomical regions, namely:...
- 8
- 222
- 0
ON A BOUNDARY VALUE PROBLEM FOR NONLINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS ROBERT HAKL Received 21 doc
... Some Boundary Value Problems for First Order Scalar Functional Differential Equations, Folia Facultatis Scientiarum Naturalium Universitatis Masarykianae Brunensis Mathematica, vol 10, Masaryk ... Systems of Linear Functional Differential Equations, Folia Facultatis Scientiarium Naturalium Universitatis Masarykianae Brunensis Mathematica, vol 12, Masaryk University, Brno, 2003 V Kolmanovskii and ... V Azbelev, V P Maksimov, and L F Rakhmatullina, Introduction to the Theory of Functional-Differential Equations, Nauka, Moscow, 1991 N V Azbelev and L F Rakhmatullina, Theory of linear abstract...
- 26
- 203
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25