infinity end behavior of a function
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ Small bold letters refer ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit...
- 9
- 622
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, ... concentrations The second primer was derived either from the known 5¢ end of the xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes ... the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of 0.3...
- 11
- 584
- 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc
... blot analysis of cytosolic sample probed with anti-(rat liver DPP III) that allowed the detection of both bands at 82 and 86 kDa anchorage of D melanogaster DPP III By comparison, the analysis of ... (Matsumoto Dental University, Nagano, Japan) The anti-(rat liver DPP III) was prepared as described by Fukasawa et al [2] Goat anti-rabbit Ig with peroxidase labelling was from Boehringer-Mannheim The ... SDS/PAGE analysis of fractions containing partially purified DPP activitiy revealed two major bands in the range of 82 and 86 kDa in both cytosolic and membrane samples (Fig 5) Western blot analysis...
- 9
- 357
- 0
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... pnas.27.4.222 Bae, J-H, Park, W-G: On stability of a functional equation with n variables Nonlinear Anal TMA 64, 856–868 (2006) doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation ... Bae and Park Journal of Inequalities and Applications 2011, 2011:82 http://www.journalofinequalitiesandapplications.com/content/2011/1/82 Page of for all x, y, z, w Î X Thus, the mapping F satisfies...
- 7
- 429
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... (2002) Kenary, HA: The probabilistic stability of a Pexiderial functional equation in random normed spaces Rend Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, ... details Department of Mathematics, College of Sciences, Yasouj University, Yasouj 75914-353, Iran 2Department of Mathematics, University of Ulsan, Ulsan 680-749, Korea 3Department of Mathematics, ... |r| + |s| A field K is called a valued field if K carries a valuation The usual absolute values of ℝ and ℂ are examples of valuations In 1897, Hensel [14] has introduced a normed space which...
- 14
- 479
- 0
Báo cáo hóa học: " Dynamic behavior of a nonlinear rational difference equation and generalization" ppt
... stability and oscillation of a family of difference equations J Math Anal Appl 294, 614–620 (2004) doi:10.1016/j.jmaa.2004.02.039 Sun, T., Xi, H.: Global attractivity for a family of nonlinear ... doi:10.1016/j.aml.2005.10.014 doi:10.1186/1687-1847-2011-36 Cite this article as: Shi et al.: Dynamic behavior of a nonlinear rational difference equation and generalization Advances in Difference Equations ... various equation listed above suggests that the same potentially holds for similar rational equations We can deduce the following natural generalization of (1.1) and (1.4) Corollary Let s Î N+ and Zs...
- 8
- 283
- 0
Báo cáo hóa học: " Qualitative behavior of a rational difference equation y = py++y yy" pdf
... is globally asymptotically stable if x is ¯ ¯ locally stable and x is also a global attractor of Equation ¯ (5) The equilibrium point x of Equation is unstable if x is not locally stable ¯ ¯ Definition ... equilibrium point x = of ¯ Equation 15 is locally asymptotically stable with initial data x0 = 1, x1 = 1.2 Authors’ contributions Xiao Qian carried out the theoretical proof and drafted the manuscript Shi ... doi:10.1186/1687-1847-2011-6 Cite this article as: Qian and Qi-hong: Qualitative behavior of a rational difference equation Advances in Difference Equations 2011 2011:6 Page of ...
- 6
- 262
- 0
Báo cáo hóa học: " Research Article Asymptotic Behavior of a Periodic Diffusion System" pot
... 1983 24 O Ladyzenskaja, V Solonnikov, and N Uraltseva, “Linear and quasilinear equations of parabolic type,” in Translations of Mathematical Monographs, vol 23, American Mathematical Society, ... “Global existence and blow-up for a nonlinear reaction-diffusion system,” Journal of Mathematical Analysis and Applications, vol 212, no 2, pp 481–492, 1997 Journal of Inequalities and Applications ... Formation, Academic Press, London, UK, 1982 Yu M Romanovski˘, N V Stepanova, and D S Chernavski˘, Matematicheskaya Biofizika, Nauka, ı ı Moscow, Russia, 1984 J Bebernes and D Eberly, Mathematical...
- 11
- 264
- 0
Báo cáo hóa học: " Research Article Monotonic and Logarithmically Convex Properties of a Function Involving Gamma Functions" pdf
... Analysis, Cambridge Mathematical Library, Cambridge University Press, Cambridge, UK, 1996 B.-N Guo and F Qi, “Inequalities and monotonicity for the ratio of gamma functions,” Taiwanese Journal ... Differential- und Integralrechnung II, VEB Deutscher Verlag der Wissenschaften, Berlin, Germany, 1966 M Abramowitz and I A Stegun, Handbook of Mathematical Functions with Formulas, Graphs, and Mathematical ... inequality,” Tamkang Journal of Mathematics, vol 31, no 2, pp 145–148, 2000 F Qi and J.-S Sun, A mononotonicity result of a function involving the gamma function, ” Analysis Mathematica, vol 32,...
- 13
- 272
- 0
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, ... point approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol 1, no 2, pp 148–153, 2007 14 S.-M Jung and J M Rassias, “Stability of general Newton...
- 7
- 257
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
- 3
- 216
- 0
Báo cáo hóa học: "ASYMPTOTIC BEHAVIOR OF A COMPETITIVE SYSTEM OF LINEAR FRACTIONAL DIFFERENCE EQUATIONS" docx
... E is an attractor and is a subset of the basin of attraction of E If F is differentiable at a fixed point E, and if the Jacobian JF (E) has one eigenvalue with modulus less than one and a second ... Nurkanovi´ , Asymptotic behavior of a two dimensional linear fractional c c system of difference equations, Radovi Matematiˇ ki 11 (2002), no 1, 59–78 c , Asymptotic behavior of a system of linear ... we showed that in cases (5) and (6) an introduction of the positive parameters a and d changed the global behavior of system (1.2) while in case (4) the global qualitative behavior of (1.2) does...
- 13
- 268
- 0
Báo cáo hóa học: "GLOBAL BEHAVIOR OF A HIGHER-ORDER RATIONAL DIFFERENCE EQUATION" doc
... 4707–4717 [10] G Papaschinopoulos and C J Schinas, Global asymptotic stability and oscillation of a family of difference equations, Journal of Mathematical Analysis and Applications 294 (2004), ... an+4 = an+3 an+2 an = an+2 an+1 an 1 an+2 an = an+1 an an 1 = an an 1 an 3 an an 1 (2.6) = an 3 If (i0 ,i1 ) = (1,2), then in a similar fashion, it is true that an+4 = an 3 for any n (2) If (i0 ... Mathematics, Guangxi College of Finance and Economics, Nanning, Guangxi 530004, China E-mail address: xhongjian@263.com Taixiang Sun: Department of Mathematics, College of Mathematics and Information...
- 7
- 242
- 0
Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Affine Projection Algorithm" docx
... signal distributions In [4], we applied and adapted the approach of [12] for analyzing the convergence behavior of multichannel FX-AP algorithms In this paper, we extend the analysis approach of ... (A. 1) CONCLUSION In this paper, we have provided an analysis of the transient and the steady-state behavior of the FX-PE-AP algorithm We have shown that the algorithm in presence of stationary ... Steady-state behavior We are here interested in the estimation of the mean-square error (MSE) and the mean-square deviation (MSD) at steady state The adaptation rule of (15) provides different values...
- 15
- 311
- 0
Báo cáo y học: " Presence of a functional but dispensable Nuclear Export Signal in the HTLV-2 Tax protein" pdf
... both Tax1 and Tax2, but amino acids 90 to 100 are also critical for the localization of the viral transactivators [16] Using prediction software as well as in vitro assays, we now describe another ... export via the CRM1 pathway, and that point mutations at positions 195 and 200 abrogate NES mediated translocation All in all, these results demonstrate that the NES sequences of Tax1 and Tax2 have ... using a Zeiss Axiocam HRc (color) camera and the Zeiss Apotome software Images of cells that are representative of the entire population are shown (C and E): Western-blot analysis of GFP and GFP-NES...
- 11
- 242
- 0
Transient thermal behavior of a homogeneous composite micro domain the hyperbolic heat conduction model
... International Journal of Energy and Environment (IJEE), Volume 5, Issue 6, 2014, pp.685-692 Faisal M AL- Ghathian Dr Faisal Al Ghathian is a faculty member of Balqaa Applied University in Jordan and ... International Conference on Thermal Engineering Theory and Applications, Beirut, Lebanon, May 31-June 4, 2004 A F Khadrawi M S Tahatand M A. Al-Nimr "Validation of the Thermal Equilibrium Assumption ... thermal capacity ratio, phase lag in heat flux References [1] D A Nield and A Bejan "Convection in porous Media", Second edition, Springer 1999 [2] B Alazmi and K, Vafai "Constant wall heat flux...
- 8
- 390
- 0
Characterization of diffusion behavior of a novel extra cellular sphingolipid associated peptide probe by fluorescence correlation spectroscopy and imaging total internal reflection fluorescence correlation spectroscopy
... distances of the confocal volume xiv List of Publications Sarita Hebbar, Esther Lee, Manoj Manna, Steffen Steinert, Goparaju Sravan Kumar, Markus Wenk, Thorsten Wohland and Rachel Kraut A fluorescent ... Role of lipid rafts in signal transduction pathways Due to their ability to diffuse laterally on the plasma membrane, rafts can act as floating shuttles that transport and bring together activated ... transduction pathways within selected areas of the plasma membrane [3] 1.2.5.2 Role of lipid rafts as platforms for entry of pathogens A broad range of pathogens, including viruses, bacteria,...
- 177
- 361
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5
... Hirakawa, H., Ohshima, K., Yamashita, A. , Shiba, T., Ogasawara, N., Hattori, M., Kuhara, S., and Hayashi, H (2002) Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater ... Rubie, E A. , Ahmad, M F., Avruch, J., and Woodgett, J R (1994) The stress-activated protein kinase subfamily of c-Jun kinases Nature 369, 156-160 Lachumanan, R., Armugam, A. , Durairaj, P., Gopalakrishnakone, ... Kotiranta, A. , Lounatmaa, K., Kari, E., Kerusuo, E., and Haapasalo, M (1997) Function of the Slayer of some Gram-positive bacteria in phagocytosis FEMS Microbiol Rev 20, 110-114 Krivan, H C., Clark,...
- 63
- 401
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 4
... detectable band indicating absence of autologous phosphorylation and endogenous or contaminant radiolabels 115 Figure 5.1 Kinetics of recombinant CDT A, time-course analysis of actin-directed ADP-ribosylation ... 5. 5A) ; the cleavage of NAD by H-bond formation of the nicotinamide carboxyamide and the amide (NO1) and carbonyl group of Arg296 with the NN7 if nicotinamide followed by spontaneous withdrawal of ... components of signal transduction pathways, is a promising pharmacologic agent that can be utilized for physiological research at the cellular to organ level It may also be tapped as an anti-tumor drug...
- 25
- 212
- 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 3
... CAGTTGTTATTTTGTACTGACATATCATATAAATACATATTTT -117 -35 -10 TATGATATATAGTTACATATTTTATGAAATTTATATAAAAAAT -74 TCTTATTTAGATTATATAATCTAAATAAATTAAAGTTCAAGAG -31 -35 -10 Start cdtA +1 TTAATTAAACTAATATTGGGAGGGAGAATAAATGAAAAAATTT ... TTAATTAAACTAATATTGGGAGGGAGAATAAATGAAAAAATTT 12 AGGAAACAT TGATGCAACATTGA 1383 Stop TACCTTAA tattttttcacataaataatttaatatttttcaa Start cdtB atttaaggAGGAGAaaca ATGAAAATACAAATGAGGAATAAA 24 Figure 3.4 Characteristic features of 20309 ... Ia botA Ttgaca* Ttgaca* Ttgaca* TTGTTA TATAAT TTAACA TTTACA TTTACA TTAGCA TTTACA TATGTC TTTACA TGCACA TTGTCAT TTAACC TATAAT TATAAT TAtAAT* TATAAA TTCAAG TTATCT CTCCTT GTCTTT TATAGT TTATTC TATTTT...
- 52
- 186
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25