incorporation of an active substance and fluid into a carrier material
Báo cáo sinh học: " The 3'''' sequences required for incorporation of an engineered ssRNA into the Reovirus genome" pot
... UGA UAA UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUCGAGACGCGAUGGUGUCAUGACCCAAGCUCAGCAGAAUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAG CUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU ... CUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU 3’ G G G G GAGGGAAUCGGAUGGCUUCAUCGGGUCCAGCCUGGCGCUCCUCCACCUCUACGGUACGGCUGGG CUACUUACACACCAGUCAGCACUCCACACACCCCCCUGGGGGAGUGAGGUUCUGCUAGUCUAUUCCCGACGUUAGCGCCGUGAUCAGCGGGGGCAUAAU ... CUA UUC AAG ACU GUU GGG UUU GGU GGU CUG CAA AAU GUG CCA AUU AAC GAC GAA CUA UC U 5’ CAT stop CAT ACG GAU CCG AGA UUU S2 (284 to 3’ terminus) 250 ACG GAU CCG AGA UUU 200 150 CUA CGC CUG AAU AAG...
- 11
- 455
- 0
Modeling and simulation of an active robotic device for flexible needle insertion
... v2 where Cn and Cp are negative and positive values of dynamic friction, bn and bp are negative and positive damping coefficients and Dn and Dp are negative and positive values of static friction, ... the amount of the axial force Their conclusion was not analytically proven DiMaio and Salcudean [7, 76] developed a planar robot to be navigated in an artificial phantom under a CCD camera supervision ... type of needles DiMaio and Salcudean simulated the needle as an elastic material using FE methods with geometric nonlinearity and 3-node triangular elements and validated this method in phantom...
- 143
- 702
- 0
A three phase voltage type PWM rectifier with the function of an active power filter
... on and off in the following manner to generate the PWh4 waveforms of the rectifier AC-side phase , voltages vjl, vi,, and vi, , d3vl: I v d and s, s, is ON when is ON and S, is OFF when is OFF ... term of the n -th harmonic component of i,, Though the AC components are also contained in the output signal of the integrator, they can be made small by the integral action of the integrator and ... sinusoidal waveform in compliance with the sinusoidal reference signal and , that the current i has a nearly rectangular waveform due to the existence of a smoothing reactor Fig3(b) shows the waveform...
- 6
- 479
- 1
Báo cáo khoa học: Glycosphingolipids in Plasmodium falciparum Presence of an active glucosylceramide synthase pot
... PPMP-treated ring forms As regards the palmitic acid labeled parasites, the same analysis was carried out In accordance, when the incorporation of palmitic acid was compared in treated and nontreated ... trihexosylceramide fraction (IV) and tetrahexosylceramide fraction (V) were extracted from the plate and analysed by UV-MALDI-TOF MS Acid methanolysis and methylation The sample was hydrolysed for 18 h at ... PercollÒ was purchased from Pharmacia Chemicals (Uppsala, Sweden) D,L-threo-phenyl2-palmitoylamino-3-morpholino-1-propanol (PPMP) was from Matreya (Pleasant Gap, PA, USA) and ceramide glycanase from...
- 11
- 376
- 0
Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot
... shank and foot Statistical analysis Continuous data were summarised in terms of means and standard deviation of the mean The differences between baseline and months follow up were investigated ... supplementary angle to the angle between pelvis and femur - right and left knee flexion: the supplementary angle to the angle between femur and shank - right and left ankle dorsiflexion: the angle ... model, allowed to measure the global postural alignment in patients with FP before and after physical activity trials and especially to analyse the possible compensatory strategies at the head and...
- 11
- 557
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
... excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy of the calculated sub-stomatal CO2 mole fraction (ci) On a chlorophyll ... were always recorded in the guard cells, and may result from an accumulation of Al via the transpiration stream +Al and +Al–CaMg plants showed similar Al concentration It should be remember that ... remained constant and similar to the value recorded in control dark-adapted leaves, i.e 0.9 3.3 Stomatal response to ABA Stomatal responses to an application of exogenous ABA via the transpiration...
- 10
- 376
- 0
báo cáo khoa học: "Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbronchial biopsy is recommended" ppt
... and Cardiovascular Diseases, Osaka 5378511, Japan 3Department of Pathology and Cytology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka 537-8511, Japan 4Department of Orthopedic ... details Department of Orthopedic Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka 537-8511, Japan 2Department of Radiology, Osaka Medical Center for Cancer and Cardiovascular ... this article as: Emori et al.: Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbronchial biopsy...
- 5
- 464
- 0
báo cáo khoa học: "Diagnosis and management of an immature teratoma during ovarian stimulation: a case report" ppsx
... Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser1, Martin Koskas1, Francine Walker2, Dominique Luton1 and Chadi Yazbeck1,3* ... teratoma in such a situation Clinical and ultrasound arguments for this immature form are scarcely or poorly evaluated Case Presentation: We describe the case of a 31-year-old Caucasian woman ... histological examination of the ovary DL and all authors read and approved the final manuscript References Trabelsi A, Conan-Charlet V, Lhomme C, Morice P, Duvillard P, Sabourin JC: Peritoneal glioblatoma...
- 11
- 256
- 0
Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc
... panel HA Ab (IgM) Non-reactive HBcAb (IgM) and HBsAg Non-reactive HC Ab Non-reactive LCMV IgG and IgM Ab titer
- 7
- 403
- 0
Báo cáo y học: " Efficacy and safety of an antiviral Iota-Carrageenan nasal spray: a randomized, double-blind, placebo-controlled exploratory study in volunteers with early symptoms of the common cold" doc
... Iota-Carrageenan and placebo and the percent of the ct values on day 3/4 was calculated as described in materials and methods The ct numbers of Iota-Carrageenan and placebo samples of day and day 3/4 ... safety-profile of Iota-Carrageenan as an active agent and Iota-Carrageenan nasal spray components in general Discussion The results of this study indicate that the Iota Carrageenan nasal spray is a safe ... reduce the severity of nasal symptoms by an antiviral effect rather than any pharmacological effect on nasal blood vessels and glands This has some advantages as pharmacological interventions to...
- 10
- 473
- 0
Báo cáo y học: "Steppingstones to the implementation of an inhospital fracture and dislocation registry using the AO/OTA classification: compliance, completeness and commitment" docx
... secondary procedures As each fracture in any patient may be operated on at several times, any first procedure (e.g a fixation of a Meling et al Scandinavian Journal of Trauma, Resuscitation and ... accuracy of the register and contributed to data extraction and writing KH made the operation planning program; ORPlan and contributed to the data extraction AJA contributed in the planning and ... complex fractures of the pelvic ring and the acetabulum, fractures and dislocations of the face, head, neck, complex fractures of the hand and some of the fractures of the thoracic and lumbar spine)...
- 9
- 325
- 0
Báo cáo y học: "Cancer control through principles of systems science, complexity, and chaos theory: A mode"
... chaos is the constantly shifting battle zone between stagnation and anarchy…place where a complex system can be spontaneous, adaptive, and alive” [4] The similarity of a fractal pattern and cancer ... evolutionary phase as the system loses its organized complexity, self-organization and self-adaptation, and looks less and less like an open system Randomness and disorganized complexity with mutations ... cell transplants Br Med J 2006; 333: 1140 18 Sainz R, Mayo J, Tan D, Lopez-Burillo S, Natarajan M, and Reiter R J Antioxidant activity of melatonin in Chinese hamster ovarian cells: Changes in...
- 10
- 440
- 0
How to get out of the friendzone: turn your friendship into a relationship
... 43 James sends Tiana an Internet video of a cat wearing mittens and sliding all over the kitchen floor Tiana responds with a video of a Maltipoo in a teacup P.M Tiana’s cubicle mate, Laura, asks ... met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each ... Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie badmouthed...
- 240
- 1,057
- 1
Tài liệu Sexual and Reproductive Health of HIV Positive Women and Adolescent Girls: A Dialogue on Rights, Policies and Services ppt
... show against many odds ‘I am a woman 42 years of age and am living with HIV for the past 17 years I am a mother of [young adult/teenaged children] My husband died and left me pregnant with the last ... especially women and young people, as well as a training package for sexual and reproductive health programme managers and providers Both publications are slated for publication by UNFPA and EngenderHealth ... In April and May of 2005, UNFPA and EngenderHealth, in collaboration with the International Community of Women Living with HIV/AIDS (ICW), Ipas and the Program on International Health and Human...
- 33
- 536
- 0
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx
... teeth shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic ... would change the appearance of her teeth considerably At the second appointment, the treatment plan was explained to the patient using the diagnostic wax-up and the unaltered original cast A diagnostic ... increased The facial midline, teeth length and angulation, anterior occlusal plan, the relation of the teeth with the lower lip at smile and with the upper lip at rest and the phonetics were evaluated...
- 5
- 378
- 0
Tài liệu SOCIAL REPRESENTATIONS OF FEMALE-MALE BEAUTY AND AESTHETIC SURGERY: A CROSS-CULTURAL ANALYSIS ppt
... link with Romanians, who also show a weaker link with Body and Beauty compared Italian and Spanish participants The second phase of data analysis, using the One Way ANOVA test and the Games Howell ... with the Italian participants b) in the Italian sample, we notice the absence of a significant association to plastic surgery and also between I and make-up and old age, and a weak negative connection ... 10 Spain 11 Argentina 12 Russia 13 Italy 14 France 15 Canada 16 Taiwan 17 United Kingdom 18 Colombia 19 Greece 20 Thailand 21 Australia 22 Venezuela 23 Saudi Arabia 24 Netherlands 25 Portugal The...
- 24
- 554
- 0
Effect of hydrogen peroxide on the destruction of organic contaminants synergism and inhibition in a con
... (bottom of the reactor vessel) Sampling from inside the reactor was taken using a sampling/drainage valve Sample filtration and analysis was performed immediately after collection 2.3 Analyses Analysis ... hours of UV irradiation Afterwards, the reactor reached steady state and the concentration of 4-CBA remained constant At steady state, the effluent concentration of 4-CBA was approximately 64% of ... mM) and reached a plateau at the higher concentration range (18–26 mM) The quantum yield was 0.04 in the absence of hydrogen peroxide and 265 0.22 at the maximum values, an enhancement factor of...
- 11
- 576
- 0
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
... PCR and ligating it into the NdeI-SalI sites of pET2 8a First, the Ec-fklB gene was amplified by PCR by using the 5¢- and 3¢-primers with the sequences of 5¢-TAAGAAAGGAAATCATATGACCA CCCCAAC-3¢ and ... partial htpX-like and dapB-like genes that are located 79 bp upstream and 84 bp downstream of the Sh-fklB gene (Fig 2) The htpX-like and dapB-like genes encode a homologue of a zinc protease and a ... temperature adaptation in psychrotrohic bacteria J Mol Microbiol Biotechnol 1, 211–219 Kato, T., Haruki, M., Imanaka, T., Morikawa, M & Kanaya, S (2001) Isolation and characterization of psychotrophic...
- 10
- 436
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25