generated with a debit to accounts in subgroup 53 or 54 and where applicable to account 473
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... phosphorylation of RLjunRP is imperative to maintain its DNA-binding domain in an active conformation RLjunRP is an 40 kDa protein that forms an 80-kDa protein–DNA adduct To assess approximate ... Phosphatase-treated nuclear extracts were assayed for their DNA-binding capacity in standard EMSA UV crosslinking of DNA–protein adduct The EMSA reaction was carried out using ng labelled Jun)25 and ... (15% acrylamide) and analysed by autoradiography changes of · binding buffer over a period of 30 and autoradiographed Affinity purification of the factor(s) interacting with the )148 to )124 region...
- 9
- 449
- 0
Tài liệu Updating a DataSet with a Many-to-Many Relationship ppt
... insert, and update records in the data source are specified for each The LoadData( ) method is called to retrieve data for each table in the DataSet Finally, the default view for the parent and the ... Create Button.Click This event handler calls the CreateData( ) method to add random data to the DataSet Modify Button.Click This event handler makes random changes to the data in the DataSet: • ... random data in both the parent and child tables and randomly creates relationships between them by adding records to the junction table UpdateData( ) This method updates all changes in the DataSet...
- 19
- 304
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... treating in ation as a random process, we are able to model expected in ation and the cost of the uncertainty associated with in ation separately In ation expectations and in ation risk premia ... decompose into in ation expectations and in ation risk premia Due to a lack of data, we cannot this, and instead we estimate in ation forward rates as part of our model Vol No Estimating In ation ... and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data forecasts...
- 32
- 347
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... to the latent factors, and use the past forecasting performance of the in ation forecasts relative to realised in ation to calibrate the standard deviation of the measurement errors Historical ... decompose into in ation expectations and in ation risk premia Due to a lack of data we cannot this and instead estimate in ation forward rates as part of our model 18 in ation, a low 2-year break-even ... and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data forecasts...
- 39
- 395
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single blot OCT, organic cation transporter; CAT, cationic amino acid ... known that transactivator domains, such as VP16, interact with a variety of transcription factors [12,13] Indeed, analysis of expression levels in stably transfected HeLa cells suggests that in high ... pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ⁄ ETTh, the 5¢ interface is...
- 8
- 331
- 0
an oh maser flare with a strong magnetic field in w75n
... maser features and the simultaneous dimming of nearby features can be interpreted as originating from the passage of a magnetohydrodynamic (MHD) shock (Alakoz et al 2005) The shock was probably ... This Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the flare which took place between ... magnetic field in water masers associated with star-forming regions is typically around 100 mG, which is about the same order of magnitude as in the OH maser flare reported here The appearance of new...
- 2
- 250
- 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
... Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf .or. jp/news/baseline/Baseline.pdf] Health and mortality survey among internally ... functioning, and disability in postwar Afghanistan JAMA 2004, 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes of Kosovar Albanians ... Caspiyavin Y, Bollini P, Truong T, Tor S, Lavelle J: The Harvard Trauma Questionnaire – Validating a Cross-Cultural Instrument for Measuring Torture, Trauma, and Posttraumatic-Stress-Disorder in Indo-Chinese...
- 10
- 647
- 0
Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx
... adjuvant chemotherapy consisting of cisplatin and taxol combined with radiotherapy, and is disease-free at the time of publication A comprehensive family history was taken and a formal pedigree was ... MLH1 stained negative and MSH2 stained positive in all tumors (Fig 3), strongly suggesting a mutation in MLH1 Differential staining for cytokeratins and 20 confirmed distinct histological origin ... positive for cytokeratin 20, whereas the ureteral tumor stained positive for both cytokeratins, demonstrating a distinct organ of origin for each tumor type and thus discounting the possibility that...
- 6
- 480
- 0
Báo cáo y học: "Redo-redo aortic root replacement with a mechanical valved conduit in a patient with von Willebrand’s disease: Case repor" pps
... into the coronary sinus to stun the heart An aortotomy was performed and 1000 ml cardioplegia was delivered into the left and right coronary ostia Most of the ascending aorta was dissected and removed ... the treatment of choice to prevent peri- and post-operative bleeding The replacement therapy can be monitored by factor assays performed in a specialist haemostasis laboratory [5] Such assays require ... submission, JA was involved in pre- and post-operative haematology care, revised and corrected the manuscript, ETB performed the operation, revised and corrected the manuscript All authors read and approved...
- 3
- 270
- 0
Báo cáo y học: "Clinical factors associated with a conservative gait pattern in older male veterans with diabetes" potx
... change, gait, balance, mental status, well being, activities of daily living, affect, behavior, range of motion, and communication In the multivariate model, diabetes, gait, and balance remained ... univariate analysis used a chi squared test with Fisher's Exact test for dichotomous data and one-way analysis of variance for continuous data The multivariate model was built using a forward stepwise ... consent approved by the Committee for Protection of Human Subjects Clinical examination One examiner and the principal investigator underwent training prior to the inception of the study in order to...
- 5
- 342
- 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf
... the final draft Do you have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach ... applicable materials became mandatory because of the morbidity associated with classical approaches and the deficiency of available well-vascularized autologous tissues for urethral reconstruction ... participated in the surgery and was involved in the clinical follow-up JR participated in the surgery, was involved in the clinical follow-up and supervised this report All authors read and approved...
- 4
- 292
- 0
Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University
... Definition of syllabus Syllabus is a common and familiar notion in language teaching and learning Many of the teachers regard syllabus as a standard material orienting them what should be taught ... explains that objective needs are those which teachers can diagnose based on analyzing personal data related to learners in corporation with information about learners‟ language proficiency and ... for a language program is an extremely complex and difficult task because it includes many teaching and learning related factors Gibbon (in Read, 1983: 141) groups these factors into two main...
- 83
- 992
- 1
A STUDY ON DIFFICULTIES IN READING ENGLISH FOR ELECTRICAL AND ELECTRONICS ENGINEERING AT VINH TECHNICAL TEACHERS’ TRAINING UNIVERSITY
... “Intensive reading means reading short texts to extract specific information This is an accuracy activity involving reading for details” And according to Nuttal (1982; 36) “Intensive reading involves ... graphs to text, relating diagram to text, predicting and sequencing the structure of a text, and reading notice and instruction 2.3 ESP reading materials Materials are very important in teaching ... often introduced in the first paragraph and summarized in the last paragraph And the main idea of a paragraph is often written at the beginning or at the end of the paragraph So, if students read...
- 35
- 1,101
- 1
Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc
... artemin indicated the lack of metal storage capacity Function of an Artemia ferritin homolog A B C Artemin, apoferritin and ferritin inhibit citrate synthase denaturation Artemin, apoferritin and ... strain BL21PRO (BD Biosciences Clontech) For expression in mammalian cells, artemin cDNA was amplified by PCR with primers 5¢-GATCCTCGAGTTAACTATAGAAGACACGGG-3¢ and 5¢-AGCTCCTAGGGCAACAGAAGGTGCAAG-3¢, ... (Sigma) Rabbits were obtained from Charles River Canada (St Constant, Quebec, Canada) and cared for in accordance with guidelines in ‘Guide to the Care and Use of Experimental Animals’ available...
- 9
- 434
- 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT ... AS-3 AS-4 AS-5 AS-6 AS-7 AS-8 AS-9 AS-10 AS-11 AS-12 AS-13 AS-14 AS-15 TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT ... 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA 5¢- CGTGGTTCACACTTTATTGCAAATC-3¢ GSTM2-revB 5¢-GATCCGTGGTTCACACTTTATTGCAAATC-3¢...
- 10
- 432
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt
... routine DVT prophylaxis with Injection Enoxaparin 40 mg subcutaneous once a day Anaesthesia was standardized and all patients received epidural anaesthesia according to standard practice Patients ... analysis of data TA was involved in the study design, analysis and was involved in critically reviewing the manuscript FA and MUC participated in the designed the Page of study and participated in the ... success are Recombinant Human Erythropoietin, tranexamic acid and Aprotinin However, none of these agents are without complications [table 2] and the most important factors to consider in the...
- 5
- 447
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" pdf
... routine DVT prophylaxis with Injection Enoxaparin 40 mg subcutaneous once a day Anaesthesia was standardized and all patients received epidural anaesthesia according to standard practice Patients ... analysis of data TA was involved in the study design, analysis and was involved in critically reviewing the manuscript FA and MUC participated in the designed the Page of study and participated in the ... success are Recombinant Human Erythropoietin, tranexamic acid and Aprotinin However, none of these agents are without complications [table 2] and the most important factors to consider in the...
- 5
- 409
- 0
Báo cáo y học: "Association of ITGAV supports a role of angiogenesis in rheumatoid arthritis Peter Ahnert and Holger Kirsten" pps
... detailed phenotype data in public databases such as dbGaP [13] for use in (disease sub-type-specific) meta-analyses ITGAV is the latest example of a candidate gene that may be relevant to RA Increased ... associations between PADI4 and CTLA4, but not with other associations [12] With OR in the range 1.1 to 1.2, variants of PADI4 and CTLA4 confer a similar risk to that of the new ITGAV variant Because ... Migliorini P, Balsa A, Westhovens R, Barrera P, Alves H, et al.: The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study Arthritis...
- 2
- 465
- 0
Báo cáo " Modeling Foreign direct investment by a Prisoner’s dilemma: Greenfield investment (cooperation) or Mergers and Acquisitions (defection) " pptx
... Player So that joint cooperation is more profitable than alternating C and D Player has an action and a strategy He (and hence the strategy) plays PD with opponent, and changes his action according ... reminds us that a large host market is an important attractor for inward FDI since it will imply higher variable profits, making it easier to compensate for the additional fixed plant costs associated ... R=(GF, GF) and P=(M &A, M &A) in Figure and expand, otherwise, T=(GF, M &A) and S=(M &A, GF,) retract Since the two indifference lines are always parallel (Fig 3), no parameter combination allows both...
- 9
- 460
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25