gary g hendrixword stress from spelling

Tài liệu Báo cáo khoa học: "word stress from spelling" ppt

Tài liệu Báo cáo khoa học: "word stress from spelling" ppt

... not used except for demonstrating the program. The procedure that assigns pseudo-weight to orthography is roughly as outlined below, ignoring morphology, etymological and more special cases ... Ferrnra Ferrell Raherty Flanagan Fuchs Gallagher Gallo Galloway Garcia from Orthography 0.96 SRom 0,92 SRom, 0.08 1,00 SRom 0.95 Swed 0.47 MF 0.45 1.00 Ger 1.00 NBrit 1.00 N Brit ... input orthography and the output strew. The orthography stress problem will be split into two subproblems: • Orthography Weight • Weight ~ Stress 3. What is Sy~ Weight: Weight is a binary...

Ngày tải lên: 21/02/2014, 20:20

8 503 0
Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm fibers to single nucleosomes pdf

Tài liệu Báo cáo khoa học: Chromatin under mechanical stress: from single 30 nm fibers to single nucleosomes pdf

... Leno GH, Zlatanova J, de Grooth BG & Greve J (2001) Unfolding individual nucleosomes by stretching single chromatin fibers with optical tweezers. Nat Struct Biol 8, 606–610. 39 Rodriguez-Campos ... rapidly decreased suggesting the per- manent removal of B4 from the nucleosomes during the initial stretching. No correlation between the dis- ruption length and the energy barrier was found. ... a relaxed zigzag structure at low ionic strength and undergoes compaction with increasing salt concentra- tion, reaching a very compact form under physiologi- cal conditions. The linker DNA arrangement...

Ngày tải lên: 14/02/2014, 18:20

13 586 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

... M2-goa1-s, 5¢- CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TT CTGCAGTTAATACAA GCCGCATCCACGAAGA-3¢. (An engineered PstI recognition site is single-underlined. The ... the following primers: M 2 -myc-EcoRI-s, 5¢-CAGAATTCatg gagcagaagctgatctccgagga ggacctg ctg GTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢. ... of GPCRs derived from evolutio- narily distant organisms for the manipulation of G protein signalling. GPCRs recognize a wide variety of ligands. Although some ligands are conserved in many organisms...

Ngày tải lên: 07/03/2014, 11:20

9 400 0
Tài liệu Distinctive Image Features from Scale-Invariant Keypoints David G. Lowe Computer Science Department ppt

Tài liệu Distinctive Image Features from Scale-Invariant Keypoints David G. Lowe Computer Science Department ppt

... developed by Torr (1995) for long-range motion matching, in which geometric constraints were used to remove outliers for rigid objects moving within an image. The ground-breaking work of Schmid and Mohr ... large change in relative magnitudes for some gradients, but are less likely to affect the gradient orientations. Therefore, we reduce the influence of large gradient magnitudes by thresholding ... larger than 0.2, and then renormalizing to unit length. This means that matching the magnitudes for large gradients is no longer as important, and that the distribution of orientations has greater emphasis....

Ngày tải lên: 13/12/2013, 16:15

28 502 0
Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

... Forward: AGG GAG AGA GTA GGC GTT GC Reverse: GGT TTA CCG AGC CAG TAC CTC T isiA Forward: GCC CGC TTC GCC AAT CTC TC Reverse: CCT GAG TTG TTG CGT CGT TA alr2495 Forward: AAA ACG GCT GCA GTT CTC ... AAT TGC AGG TGT ACC alr3088 Forward: GTT TTA GTT TCT GTT ATT TAC GGT CAA Reverse: TTC TCT GTC GCC GGT GGG GAT alr1457 Forward: AAT ATC GCC GTT AAC TTC GC Reverse: GCC TTG GTG ACA ATT ATG TA alr2505 ... osiS gene in E. coli strains was per- formed as following: a DNA fragment corresponding to the entire coding region of alr2505 was amplified by PCR using the Osi top primer 5¢- GAATTCATGTCTAATCGTCCTA- TATATC-3¢...

Ngày tải lên: 18/02/2014, 04:20

11 728 0
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

... obtained from Biomol (Plymouth Meeting, PA), Sephadex G- 25 and G- 50 from Amersham Biosciences (GE Healthcare, Piscataway, NJ), Cleland’s reagent (dithio- threitol) from Calbiochem (San Diego, CA), ... aldehydes via binding of released zinc to pro- tein sulfhydryls is evident from the effects of released zinc on gene expression (Fig. 6) and phosphorylation signaling (Fig. 7). Short-chain alcohols ... in control HepG2 cells is 75.4 ± 7.6 ngÆ (g cells) )1 (Fig. 6). Treating the cells with ethanol, a known inducer of MT [17], for 12 h increases the concentration of MT to 101 ngÆ (g cells) )1 . To...

Ngày tải lên: 19/02/2014, 06:20

11 474 0
Credit at times of stress: Latin American lessons from the global financial crisis pot

Credit at times of stress: Latin American lessons from the global financial crisis pot

... openness and savings ratios in emerging markets (Regional percentage averages) Financial openness index 2007 1 Trade openness indicator (X+M)/GDP (average 2004-07) National savings rates as ... Highlighting Monetary Policy Challenges from a Negative Asset Price Bubble Perspective Andrew Filardo 355 November 2011 Anchoring countercyclical capital buffers: the role of credit aggregates ... Thailand. Finally, Emerging Europe is: Bulgaria, the Czech Republic, Estonia, Hungary, Latvia, Lithuania, Poland and Romania. Graph 1 Real credit: growth and cycle by regions 1 Growth rates 2 ...

Ngày tải lên: 06/03/2014, 08:20

44 712 0
Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf

Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf

... (reverse) GAGTCGTTGAAGTAGGCTGGAACTG Hsc70-1 (forward) TGCTGGATGTCACTCCTCTGTCTC 87 Hsc70-1 (reverse) TGGGTATGGTGGTGTTCCTCTTAATC Hsp83 (forward) GGACAAGGATGCCAAGAAGAAGAAG 150 Hsp83 (reverse) CAGTCGTTGGTCAGGGATTTGTAG Fig. ... (forward) TGGATGAACCCACACCCAATC 89 Hsp67Ba (reverse) CGAGGCAACGGGCACTTC Hsp68 (forward) GAAGGCACTCAAGGACGCTAAAATG 88 Hsp68 (reverse) CTGAACCTTGGGAATACGAGTG Hsp70Aa (forward) TCGATGGTACTGACCAAGATGAAGG ... CTCCTCGTGCTTCCCCTCTACC Hsp40 (forward) GAGATCATCAAGCCCACCACAAC 112 Hsp40 (reverse) CGGGAAACTTAATGTCGAAGGAGAC Hsp60 (forward) ACATCTCGCCGTACTTCATCAACTC 66 Hsp60 (reverse) GGAGGAGGGCATCTTGGAACTC Hsp67Ba...

Ngày tải lên: 06/03/2014, 09:22

12 389 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

... underlined) 5¢-CTAGGTGAA CATATGAGTGAGGAAAGAATTCC-3¢ and the reverse primer 5¢-GGAGCTGGATTAATG CTC GAGTCTCCTATTAG-3¢ (the inserted XhoI restriction site is underlined). The PCR products obtained were purified from ... Storz G & Zheng M (2000) Oxidative stress. In Bacter- ial Stress Responses (Storz, G & Hengge-Aronis, R, eds), pp. 47–59. ASM Press, Washington, DC. 3 Touati D (2000) Iron and oxidative stress ... purified to homogeneity in a two-stage process using affinity chromatography on HisTrap HP and gel filtration on HiLoad Superdex 75 obtaining 30 mg and 18 mg, respectively. The SDS ⁄ PAGE of the final...

Ngày tải lên: 07/03/2014, 12:20

11 566 0
Báo cáo Y học: IgE reactivity of tandem repeats derived from cockroach allergen, Bla g 1 docx

Báo cáo Y học: IgE reactivity of tandem repeats derived from cockroach allergen, Bla g 1 docx

... IgE binding to occur. Therefore, folding of more than one duplex is not necessary to create an IgE binding epitope. Given the repeated structure of Bla g 1, the degree of IgE binding to Bla g ... by the German cockroach (Blattella germanica) is common [2–5]. Several German cockroach allergens have been cloned including Bla g 1, Bla g 2, Bla g 4, Bla g 5 and Bla g 6 [6–10]. Bla g 1 is ... exposure to > 2 U g )1 Bla g 1 is a strong risk factor for sensitization [5,15]. A recent report suggested that exposure to Bla g 1 or Bla g 2 at 3 months of age predicted allergen-specific...

Ngày tải lên: 08/03/2014, 23:20

7 282 0
Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx

Báo cáo khoa học: Oxidative stress induces a reversible flux of cysteine from tissues to blood in vivo in the rat pptx

... propargylglycine (PGG). Both GSH and Cys can be exported from cells into plasma, where they undergo auto-oxidation. The liver and kidneys appear to have significant capacity for GSH efflux. Although ... ⁄ CySS or GSH ⁄ GSSG pool (e .g. 21 and 9 mV changes, respectively, as observed in aging) is sufficient to cause a large increase in the oxidized forms of intracellular proteins bearing vicinal ... efflux from a single organ because of pathophysiological conditions, and, more importantly, the influence of oxidative stress on these processes. Our data clarify some of these aspects, and suggest...

Ngày tải lên: 16/03/2014, 02:20

13 510 0
Báo cáo khoa học: The crystal structure of annexin Gh1 from Gossypium hirsutum reveals an unusual S3 cluster Implications for cellulose synthase complex formation and oxidative stress response potx

Báo cáo khoa học: The crystal structure of annexin Gh1 from Gossypium hirsutum reveals an unusual S3 cluster Implications for cellulose synthase complex formation and oxidative stress response potx

... – IIB-IVB Glu113-Arg271 Glu116-Arg272 Glu112-Arg271 IIB-IVB CO117-Arg276 CO120-Arg277 – IIA-IIB Asp39-Arg118 Asp96-Arg121 Asp92-Arg117 IVB-IVC Arg276-Asp280 Arg277–281 Arg276-Asp280 2560 A. Hofmann ... positively charged patch between domains III and IV. This figure was prepared with GRASP [36]. Table 2. Conservation of salt bridges. Anx(Gh1) Anx24(Ca32) AnxA5 IE-IIA Arg80-Glu99 – – IIB-IVB Glu113-Arg271 Glu116-Arg272 ... Tyr192 IIIDE Lys230 Gly231 IVAB Arg261 Arg262 IVAB Arg262 Arg263 Fig. 2. The membrane binding loops. The IAB loops of Anx(Gh1) (A) and AnxA5 (B) are shown in the same view from the front. (C) and (D)...

Ngày tải lên: 17/03/2014, 03:20

8 476 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... primer: 5¢-GATGTTGATGGTGATGGTCA-3¢; reverse primer: 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; reverse primer: 5¢-GAACCA CCGATCCAGACACT-3¢) ... oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo III, 5¢-GTTTTTATCCGATGCAAATTTTTGCTTTGT GATTG-3¢. The ... multiple stresses and probably has a role at the very beginning of multiple stress signaling pathways [37]. Involvement of CDPKs in stress signaling has also been shown by using chimeric gene constructs...

Ngày tải lên: 18/03/2014, 01:20

12 365 0
From regional Pioneer to g lobal Contender our vision the economic vidion 2013 for bahrain pptx

From regional Pioneer to g lobal Contender our vision the economic vidion 2013 for bahrain pptx

... rapidly growing and aging population and will address the key risk factors. The government will play a vital role in improving the health system along the following levers: Promoting and encouraging ... improving their recruitment and training, enhancing the management of their performance, improving their image in society, and increasing the attractiveness of careers in teaching 16 | From Regional ... a national competitive advantage as emerging global centres of low-cost manufacturing are gradually eroding this edge. We now need to rethink our place in the global value chain and identify...

Ngày tải lên: 23/03/2014, 20:20

26 221 0

Bạn có muốn tìm thêm với từ khóa:

w