Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress Marion Ruiz, Azzeddine Bettache, Annick Janicki, Daniel Vinella, Cheng-Cai Zhang and Amel Latifi Aix-Marseille Universite ´ and Laboratoire de Chimie Bacte ´ rienne, IBSM-CNRS, Marseille, France Introduction Sulfur is present in a wide range of biomolecules with various chemical features, including enzymes catalyzing many important chemical reactions. During the last decade, considerable progress has been made towards understanding sulfur-trafficking processes in various organisms, with particular attention being paid to the enzymes that catalyze the reactions involved. Pyridoxal 5¢-phosphate (PLP)-dependent cysteine desulfurases have been found to provide the sulfur required for a wide range of cellular processes, such as the synthesis of molybdopterin [1–3], thiamin [4,5], the thionucleo- tides in tRNA [6–9] and the assembly of Fe-S clusters [10–15]. The first cysteine desulfurase to be discovered was the NifS protein, which is involved in the forma- tion of the nitrogenase Fe-S cluster in Azotobac- ter vinnelandii [15]. Subsequently, cysteine desulfurases have been identified in many organisms and classified on the basis of sequence similarities into two groups: I and II [16]. Group I contains the NifS proteins themselves and other subsets of cysteine desulfurases that are not restricted to diaztrophic organisms, namely the ISC and NFS proteins. All the members of this group have the consensus sequence SSSGSAC(T ⁄ S)S in com- mon. The members of group II, which includes the enzymes SufS, CsdA and CpNifS, have the consensus sequence -RXGHHCA- [16]. The cysteine desulfurases in both groups are homodimers that use PLP to cata- lyze the elimination of sulfur from l-cysteine, yielding alanine and either sulfane (S°) or sulfide (S = ), in the presence of a reducing agent. This reaction involves the formation of a persulfide intermediate (R-S-SH) that is bound to an essential cysteine residue close to the C-terminus of the enzyme. The existence of this intermediate was first established in NifS from A. vinn- elandii and, subsequently, based on structural studies, in SufS from Escherichia coli [17,18]. The persulfide cleavage is the rate-limiting step in the processes of catalysis. A new catalytic cycle can only occur once Keywords Anabaena; cysteine desulfurase; Fe-S clusters; oxidative stress; sulfur transfer Correspondence A. Latifi. Laboratoire de Chimie Bacte ´ rienne, IBSM-CNRS, 31 Chemin Joseph Aiguier, 13402 Marseille, Cedex 20, France Fax: +33 4 91 71 89 14 Tel: +33 4 91 16 41 88 E-mail: latifi@ifr88.cnrs-mrs.fr (Received 22 May 2010, revised 27 June 2010, accepted 12 July 2010) doi:10.1111/j.1742-4658.2010.07772.x NifS-like cysteine desulfurases are widespread enzymes involved in the mobi- lization of sulfur from cysteine. The genome of the filamentous diazotrophic cyanobacterium Anabaena PCC 7120 contains four open reading frames potentially encoding NifS-like proteins. One of them, alr2505, belongs to the pkn22 operon, which enables Anabaena to cope with oxidative stress. The Alr2505 protein was purified and found to share all the features characteris- tic of cysteine desufurases. This is the first NifS-like enzyme to be function- ally characterized in this bacterium. On the basis of the transcriptional profiling of all nifS-like genes in Anabaena, it is concluded that alr2505 is the only cysteine desulfurase-encoding gene induced by oxidative stress. The function of Alr2505, which was termed OsiS, is discussed. Structured digital abstract l MINT-7966515: osis (uniprotkb:Q8YU51) and osiS (uniprotkb:Q8YU51) physically interact ( MI:0915)bytwo hybrid (MI:0018) Abbreviations PLP, pyridoxal-5¢-phosphate. FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3715 the sulfur atom is released from the persulfide and the active site of the enzyme (i.e. the cysteine residue) becomes accessible [17]. In vitro, this step can be achieved by decomposing the persulfide into sulfide in the presence of thiols, whereas, in vivo, it involves the transfer of the persulfide-sulfur sulfane to a cysteine residue of a sulfur acceptor protein. In E. coli, these transpersulfuration reactions take the form of sulfur being transferred from the cysteine desulfurases SufS and CsdA to their sulfur acceptors, SufE and CsdE, respectively [19,20]. In cyanobacteria, cysteine desulfurases have been characterized in functional terms only in the case of Synechocystis PCC 6803. This unicellular nondiazo- trophic cyanobacterium possesses four ORFs, in which the corresponding proteins show sequence similarities with NifS (Slr0387, Sll0704, Slr5022 and Slr0077). Slr0387, Slr5022 and Sll0704 belong to the group I cys- teine desulfurases, whereas Slr0077 belongs to group II. The cysteine desulfurase activities of Slr0387 and Sll0704 have been characterized in vitro [21–23]. Both proteins were found to be able to deliver sulfur to apoferredoxin, and the finding that slr0387 and sll0704 mutants were obtained suggested that none of them was essential for the viability of this cyanobacterium [24]. The cellular targets to which these proteins trans- fer sulfur remain unknown. Slr0077 (SufS) appears to be the essential cysteine desulfurase of Synechocystis PCC6803 because attempts to obtain a fully-segregated mutant of this gene have proved unsuccessful [24]. Structural charac- terization of this critical cysteine desulfurase suggested that, similar to SufS and CsdA of E. coli, it might require an accessory sulfur acceptor protein [25]. The Slr0077 protein has been found to catalyse cysteine desulfuration, as well as the conversion of cystine into pyruvate, via a cystine lyase reaction that does not require the conserved cysteine residue C372 [25,26]. The genome sequence of the filamentous cyanobacte- rium Anabaena PCC7120 contains four ORFs, the products of which (all1457, alr2495, alr3088 and alr2505) show significant similarities to cysteine desul- furases [27]. The all1457 (nifS) gene has been reported to be part of the nif operon, which is devoted to nitro- gen fixation in this cyanobacterium [28], although, to date, none of the cysteine desulfurase enzymes have been characterized functionally. In the present study, which focused on the activity of Alr2505, it is estab- lished that this enzyme effectively shows features typi- cal of cysteine desulfurase. The alr2505 gene is part of the pkn22 operon, which also encodes the serine ⁄ threo- nine kinase Pkn22 and the peroxiredoxine PrxQ-A. In a previous study, it was demonstrated that this operon contributes importantly to the resistance of Anabaena to oxidative stress [29,30]. Because alr2505 is the only cysteine desulfurase-encoding gene induced in res- ponse to oxidative stress, we named the corresponding protein oxidative stress-induced cysteine desulfurase (OsiS). Results Alr2505 belongs to the NifS-like protein family In a previous study, we began to investigate the contri- bution of the pkn22 operon to the response of Anabae- na to oxidative stress. The pkn transcriptional unit is composed of four ORFs: Alr2502, Alr2503, Asr2504 and Alr2505, the expression of which is specifically induced when Anabaena is exposed to oxidative condi- tions [30]. We established that Alr2502 (Pkn22) is a serine ⁄ -threonine kinase that regulates the CP43 ¢ (IsiA) protein [29], and that Alr2503 (PrxQ-A) is a proxire- doxin involved in defence against the oxidative stress by reducing reactive oxygen species [30]. The present study aimed to establish the function of the Alr2505 protein encoded by the last gene of this operon, which has been annotated as a putative aminotransferase in Cyanobase (http://www.kazusa.or.jp/cyano/Anabaena/ index.html). To further investigate this prediction, sequence alignment was performed on this protein, and the results obtained showed that Alr2505 demon- strates high levels of similarity with group I cysteine desulfurases, according to the classification of Mihara and Esaki [16]. Not only the conserved amino acid ele- ments characteristic of this family of proteins (i.e. the His-Lys motif required for PLP-cofactor binding and an essential Cys residue at the active site) [15] are pres- ent in Alr2505, but also the consensus sequence around the active site (SSSGSACSS) is of the NifS- type (Fig. 1B). The 3D structure of OsiS was predicted using the phyre server [31]. The crystal structure of IscS [32] was consistently selected as a top candidate, with an e-value of 2.78 · 10 )43 . The superposition of OsiS and IscS predicts an overall structure of OsiS monomer that is highly similar to that of IscS (Fig. 1A), with a two-domain organization and the presence of both a-helices and b-strands. On the basis of these data and the fact that alr2505-expression is specifically induced under oxidative stress, we nemed this protein OsiS. Spectrophotometric properties of OsiS To confirm the activity of OsiS predicted from the sequence-alignment data presented above, the osiS OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al. 3716 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works gene was overexpressed in the heterologous host E. coli. Purification of the OsiS protein was difficult because it tended to aggregate into inclusion bodies. Because the histidine-tag can influence the solubility and the folding of the protein in some cases, we also purified the OsiS protein without any tag, using a mono-Q purification column. This method of purifica- tion did not improve the solubility of the protein or affect its activity; therefore, we continued our investi- gation using the His-tagged protein. Among the vari- ous experimental approaches tested, solubilization by urea was found to be the most efficient method of purification, and this method was used to obtain the enzyme followed by removal of urea and refolding. Pure OsiS showed the characteristic yellow colour observed in the case of other PLP-containing enzymes, including all the NifS-like proteins studied to date. UV visible spectra showed an optimum for A 390 (Fig. 2A), which is consistent with the presence of PLP associated with the protein moiety. The addition of 0.1 mm cyste- ine to the protein sample induced a shift in the major peak in the range 390–420 nm, which indicates that some interaction occurred with the cysteine substrate (Fig. 2A). These spectral changes were not observed when 0.1 mml-cystine was added instead of l-cyste- ine. Therefore, tt is unlikely that l-cystine serves as a substrate of OsiS (data not shown). OsiS–OsiS interactions Because all NifS-like proteins are homodimers, we aimed to assess whether OsiS also shows this feature. The interactions between OsiS monomers were ana- lyzed using a bacterial two-hybrid system originally described by Karimova et al. [33]. This system exploits the fact that the catalytic domain of adenylate cyclase C-term N-term A B A lr2505 Ana VSSGSACSSTKTAPSHVLTA 342 Slr0387 Syn LSSGSACSSYRTEASHVLYA 339 IscS A.Vin VSSGSACTSASLEPSYVLRA 34 1 IscS E.coli VSSGSACTSASLEPSYVLRA 34 1 IscS V.fis VSSGSACTSASLEPSYVLRA 356 A tNfsl Ara VSSGSACTSASLEPSYVLRA 262 N ifs Ana ASSGSACTSGSLEPSHVLRA 337 ******:* .*:** * Fig. 1. Sequence analysis. (A) Prediction of the tertiary structure of OsiS was performed using the PHYRE server (http://www.sbg.bio.ic. ac.uk/phyre/) and the results were analyzed and visualized using UCSF CHIMERA software (http://www.cgl.ucsf.edu/chimera/download. html) [53]. The tertiary structure of IscS monomer was predicted using the PHYRE server. The two structures were then superposed. The IscS monomer is shown in red and the OsiS monomer in yellow. (B) Proteins similar to Anabaena OsiS (alr2505) were aligned using CLUSTAL W. Alr2505, Anabaena OsiS; Slr0387, Synechocystis PCC6803 (accession number NC_000911.1); IscS, Azotobacter vinelandii (accession number AAC24472) IscS, E. coli str. K-12 (accession number AAT48142); IscS Vibrio fischeri (accession number YP_002155374.1) AtNFSI, Arabidopsis thaliana (accession number NP_001078802); NifS Anabaena (accession number AAA22006). Only the region surrounding the catalytic cysteine is shown. 0.21 0.22 0.16 0.17 0.18 0.19 0.2 0.12 0.13 0.14 0.15 Wavelength per nm 300 350 400 450 500 180 80 100 120 140 160 0 20 40 60 T18/T25 OsiS/OsiS β-Gal activities (MU) A B Fig. 2. Physical characteristics of OsiS. (A) Absorption spectra of OsiS were recorded before (bold line) and after (discontinued line) adding 0.1 m M of L-cysteine. (B) Protein–protein interactions between OsiS monomers. OsiS–OsiS interactions were detected using an E. coli two-hybrid approach. OsiS was fused to the T18 and T25 fragments. The T18 ⁄ T25 combination was used as the negative control. b-Galactosidase activities are expressed in Miller units (MU). Values shown are the means of three independent experiments. M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3717 of Bordetella pertussis consists of two complementary fragments, T25 and T18. These fragments are not active when physically separated. However, if these fragments are fused to interacting proteins, homo- or heterodimerization of the resultant hybrid proteins reconstitutes an active adenylate cyclase. The cAMP– catabolite activator protein complex can than activate the transcription of target genes (e.g. those of the lac operon). Thereby, b-galactosidase activities obtained during two hybrid reconstitution reflect the dimeriza- tion of the proteins fused to the T25 and T18 frag- ments [33]. Two-hybrid reconstitution systems have been used to assess the dimerization of SufS and CsdA cysteine desulfurases from E. coli [20,34], as well as NifS from Rhodobacter capsulatus [3]. The fact that the b-galactosidase activities, obtained with T15-OsiS and T28-OsiS, were significantly higher than those of the negative controls confirmed the specificity of the OsiS– OsiS interactions (Fig. 2B), strongly suggesting that OsiS is able to form homodimers. Cysteine desulfurase activity of OsiS To determine whether OsiS displays cysteine desulfur- ase enzymatic activity, its ability to catalyze the production of alanine from cysteine was tested. Apparent kinetic parameters were obtained, and the enzyme showed Michaelis–Menten behaviour (Fig. 3). The K m value was estimated to be approximately 0.057 ± 3.54 mm, and V max was 190 ± 5.6 nmol ala- nineÆmin )1 Æmg protein )1 , which is consistent with the kinetic parameters of SufS-type cysteine desulfurases, rather than those of IscS [25,35]. When the cysteine desulfurase activity of OsiS was monitored in the pres- ence of apoferredoxin and iron, 2.5-fold more alanine was produced (Table 1). The stimulation of OsiS activ- ity in the presence of apoferredoxin suggests that OsiS is able to transfer sulfur to apoferredoxin in vitro. The three cysteine desulfurases from E. coli have been found to catalyze abortive transamination reac- tions, which convert the l-cysteine into pyruvate and the PLP into pyridoxamine 5¢-phosphate, thus inacti- vating the enzyme [35]. The production of pyruvate from cysteine by OsiS was measured and found to be approximately 32 nmol pyruvateÆmin )1 Æmg OsiS )1 . Pyruvate can also be produced from cysteine by cyste- ine lyase enzymes via a b-elimination reaction [26]. We therefore wanted to establish whether pyruvate production by OsiS resulted from a lyase-type reaction. Accordingly, pyruvate formation catalyzed by OsiS was measured in the presence of b-chloroalanine, which is known to inhibit only the desulfurase reac- tion. Because no pyruvate was produced under these conditions, it was concluded that OsiS is able to cata- lyze abortive transamination processes. Cys329 residue is likely the catalytic residue in OsiS The sequence alignment data obtained indicate that the Cys329 residue is strictly conserved in all NifS-like proteins. We therefore constructed a mutant of the OsiS protein (OsiS329S) in which the Cys329 residue was replaced by a serine residue. This mutant protein was subsequently purified from E. coli using the same procedure as that employed for OsiS. OsiSC329S proved to be unable to sustain any cysteine desulfurase activity (Table 1), which strongly suggests that Cys329 would be the catalytic residue. The replacement of this cysteinyl residue with a serine neither affected the spec- troscopic properties of OsiS, nor abolished its ability to form dimers (data not shown). C y steine ( µ M) Velocity (nmole alanine·min –1 ·mg –1 OsiS) 160 140 120 100 80 60 40 20 0 0 20 40 60 80 100 120 140 160 180 Fig. 3. Cysteine desulfurase activities of OsiS. Graph showing the rate-dependency of the reaction on substrate concentrations. Assays were performed at 37 °Cin25m M Tris-HCl (pH 7.5), 50 m M NaCl, 10 mM dithiothreitol in the presence of 1 lM OsiS and L-cysteine as the substrate. The production of alanine was determined as described in the Experimental procedures. The line gives the best fits generated with ORIGIN 6.1 software (OriginLab Corporation Northhampton, MA, USA), based on the equation V = V max [S] ⁄ (K m +[S]). Table 1. Cysteine desulfurase activity of OsiS and OsiS C329S. Enzyme Cysteine desulfurase activity (nmol alanineÆmin )1 Æmg protein )1 ) )Apoferredoxin +Apoferredoxin a OsiS 123 ± 04 308 ± 06 OsiS C329S 0 Not determined a Additional details are provided in the text. OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al. 3718 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works Expression and genomic organization of cysteine desulfurase-encoding genes In addition to osiS, analysis of the genome of Anabae- na PCC 7120 [27] reveals the presence of three other putative nifS-like genes (alr3088, alr1457 and alr2495). The transcript levels of these four genes in Anabaena were investigated under either standard growth condi- tions or oxidative stress. The latter was obtained by treating the cyanobacterial culture with methyl violo- gen. As a positive control, we also investigated the level of expression of the isiA transcript, which was previously found to be up-regulated under oxidative stress conditions [36,37]. The transcription of all these genes was assessed using the semi-quantitative RT-PCR approach, as described in the Experimental procedures. The increase observed in the level of isiA transcript confirmed the establishment of oxidative stress conditions in the cells under the present experi- mental conditions (Fig. 4A). In response to methyl viologen treatment, only alr2505 (osiS) expression was induced, whereas the weak expression of alr2495 was constitutive. The all3088 gene encoding a putative group I cysteine desulfurase was not expressed under our experimental conditions. Lastly, as expected, the all1457 (nifS) gene was not expressed under either of the two conditions tested (Fig. 4A). The nifS gene has been reported to be part of the nifB operon, the expression of which occurs only after a DNA-arrange- ment event induced during heterocyst differentiation [28]. It has been suggested that the nifB, nifS and nifU genes, in view of their similarity with the correspond- ing genes from other diazotrophs, may be involved in the maturation of nitrogenase [28]. Group 1 all1457 nifS all1516 fdxN all1517 nifB all1456 nifU alr2505asr2504 alr2495 alr2505 Group 2 alr3088 alr3088 alr2495 sufS alr2494 sufD alr2493 sufC alr2492 sufB all1457 SufE-likeSufA-likeNifU-like isiA rnpB all1431 alr2385 alr3513 asr1309 alr0692 all4341 030 60 pkn22 prxQ-A AB C Cysteine desulfurase Ferredoxin NifB:FeMoco core assembly Scaffold Energy producing system A-type carriers Sulfur acceptor protein Fig. 4. Expression and genomic organization of cysteine desulfurase-encoding genes. (A) RT-PCR analysis of cysteine desulfurases and cyst(e)ine lyase genes. RNA was collected from cells grown in BG11 medium (line 0) or in BG11 incubated for 30 min (line 30), or 1 h (line 60) with 50 l M of methyl viologen. One microgram of RNA was used in each experiment. Samples were collected at the exponential phase of the PCR. All RT-PCR experiments were repeated twice, and similar results were obtained consistently. Expression of the rnpB gene was used as the control assay. All the primers used in the experiment were initially checked in PCR reactions with Anabaena genomic DNA as the template, at the same annealing temperatures as those used in the RT-PCR experiments. (B) Organization of cysteine desulfurase- encoding genes in Anabaena genome. The classification of the corresponding enzymes is indicated. The ORFs surrounding these genes are indicated. (C) Anabaena genome search for ORFs relevant to the Fe-S cluster assembly. M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3719 In addition to the Nif system, which is specifically devoted to nitrogenase maturation, two other Fe-S assembly systems exist in bacteria. The role of these mechanisms has emerged mainly from studies on E. coli [38,39]. The ISC system (Fe-S cluster forma- tion) comprises the housekeeping Fe-S assembly sys- tem, whereas the SUF (sulfur mobilization) system appears to be required under oxidative stress or iron starvation conditions. The three systems (NIF, ISC and SUF) have in common the involvement of a cyste- ine desulfurase, a scaffold protein that serves as a con- struction site for Fe-S clusters before their transfer to the apoproteins, and an A-type scaffold protein that serves as a Fe-S cluster carrier [40]. In addition, the ISC and SUF systems include ATP-hydrolyzing pro- teins such as the SufBCD complex. This ATPase com- plex in the SUF system has been shown to have a scaffold function in E. coli [41]. Among the four cysteine desulfurase genes from Anabaena, only two are co-localized with genes involved in sulfur transfer processes: the nifS gene, as explained above, and the alr2495 (sufS) gene (Fig. 4B). In addi- tion to the sufS gene, the former cluster includes ORFs which are similar to the SufBCD proteins. Furthermore, our bioinformatic analysis on the Anabaena genome demonstrated the presence of ORFs showing similarities with the NifU scaffold, the A-type scaffold SufA and the sulfur acceptor SufE (Fig. 4C). The relevance of this analysis in terms of OsiS function is discussed below. IscR maturation in an iscS sufS mutant of E. coli expressing osiS To assess whether OsiS could be involved in the bio- genesis of Fe-S clusters, we investigated whether it could compensate for the lack of cysteine desulfurase in E. coli. We used the DV1247 strain (iscS sufS) mutant that also harbours an iscR::lacZ fusion [42]. IscR is a Fe ⁄ S protein encoded by the first gene of the isc operon, and it is involved in the transcriptional regulation of both the isc and the suf operons. In its holoform, IscR represses the isc operon transcription, whereas, in its apoform, it acts as an activator of the suf operon [43,44]. In the iscS mutant, the IscR regula- tor is not maturated [43] and can hence activate the suf operon transcription. To avoid a possible effect of SufS over-expression as a result of the iscS mutation, we used the double mutant iscS sufS rather than a simple iscS mutant. The activity of the iscR::lacZ fusion was assessed in the genetic backgrounds reported in Fig. 5. As expected, in the absence of the IscS and SufS cysteine desulfurases, the activity of the iscR::lacZ fusion was de-repressed compared to the wild-type context (MG1655 strain). However, when the expression of the osiS gene was induced from the pBAD promoter, the fusion showed the same activity as in the wild-type background. This result suggests that, when osiS is over-expressed, the maturation of the IscR repressor occurred sufficiently to allow it to fulfil its function. Furthermore, the observation that the effect of OsiS was strictly dependent upon the pres- ence of arabinose strongly confirms the above conclu- sion. Because the maturation of IscR might need a supply of sulfur specifically from IscS (D. Vinella, unpublished results), we conclude that, in the DV1247 strain, OsiS over-production compensates for the absence of IscS with respect to IscR maturation. Discussion In the present study, the first functional characterization of a cysteine desulfurase in Anabaena 7120 is presented. OsiS is encoded by the last gene of the pkn22 operon, which contributes to the response to oxidative stress, as previously described [29,30]. OsiS shows all the proper- ties and features typical of NifS-enzymes: (a) its amino acid sequence includes the consensus sequence of the group I cysteine desulfurases; (b) OsiS is a homodimer and binds to a PLP cofactor; and (c) it catalyzes the formation of alanine and sulfide, using l-cysteine as a substrate. The results of site-directed mutagenesis A β β -Gal activities (MU) BCD 1400 1200 1000 800 600 400 200 0 Fig. 5. b-galactosidase activities of the IscR::lacZ fusion. The MG1655 (iscR::lacZ) or the DV1247 strain and its recombinant derivatives were grown overnight in LB medium as explained in the Experimental procedures. Cultures were used to inoculate fresh LB medium supplemented (or not) with arabinose. The b -galactosidase activities were measured as described in the main text. The data are the means of values obtained from three independent clones. The experiment was repeated twice. A, MG1655 (iscR::lacZ); B, DV1247 ⁄ pBAD24; C, DV1247 ⁄ pBAD24:osiS plus arabinose; D, DV1247 ⁄ pBAD24:osiS minus arabinose. OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al. 3720 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works showed that the cysteine residue C329 is the binding site of the persulfide intermediate. The kinetic properties of OsiS indicate that it has a weak cysteine desulfurase activity. Similar activities have been reported in the case of cysteine desulfurases from other organisms. In some cases, it was concluded that this inefficiency reflects the involvement of an accessory factor that accepts the sulfur from the enzyme, and thus enhances its activity. This was found to be the case, for example, with SufS of E. coli, which is stimulated by the SufE protein [25,34,35,45]; sufS and sufE genes belonging to the same operon. The pkn22 operon lacks a sufE-like gene (Fig. 4B). How- ever, the Anabaena genome contains a putative ORF (Alr3513) encoding a protein showing 31% identity with SufE (Fig. 4C). Whether this SufE-like protein may act as a sulfur acceptor for OsiS will be the sub- ject of future studies. The stimulation of the OsiS activity by the presence of apoferredoxin is consistent with the suggestion that sulfur transfer to an acceptor protein may facilitate the turnover of OsiS and enhance its activity (Table 1). It is likely that the in vitro catalysis of holoferredox- in reconstitution in the presence of iron is ability com- mon to most cysteine desulfurases. This property has often been considered to reflect the involvement of these enzymes in the biogenesis of Fe-S clusters. Indeed, such a conclusion can only be made with great caution because this in vitro finding simply means that these enzymes are able to deliver sulfur, and does not necessarily reveal the nature of the targets to which the sulfur is transferred. The question remains con- cerning the role of OsiS in vivo. Because the level of expression of the osiS gene is undetectable under stan- dard growth conditions, it can be concluded that OsiS is not required for housekeeping purposes. The most likely hypothesis appears to be that this protein con- tributes to cell defence against oxidative stress. It has been established that some reactive oxygen species can react with Fe-S clusters and thus induce their oxida- tion [46]. The repair and ⁄ or synthesis of damaged Fe-S clusters under oxidant conditions therefore represents an important challenge. It is tempting to speculate that OsiS may contribute to these processes by providing sulfur, when Anabaena is exposed to an oxidative threat. The fact that the over-expression of OsiS com- plements the iscS mutation for the maturation of IscR confirms this hypothesis. However, OsiS could not res- cue the auxotrophy of the iscS mutant for thiamine (data not shown). Whether this result would mean that OsiS could deliver sulfur only to Fe-S biogenesis path- ways or also to other sulfur-using biosynthetic path- ways in Anabaena remains unanswered. On the basis of the data obtained for the Anabaena genome presented in Fig. 4, it is tempting to speculate that the SUF system [alr2492(SufB), alr2493(SufC), alr2494(SufD), alr2495(SufS)] might be the housekeep- ing Fe-S assembly system in this cyanobacterium. Indeed, Anabaena lacks a counterpart of the ISC sys- tem, and a group 2 cysteine desulfurase was found to be the essential cysteine desulfurase in Synechcoystis PCC6803 [25]. Because the alr3088 gene is not expressed under normal growth conditions (Fig. 4A), it is likely that its product (a group 1 cysteine desulfur- ase) may be required under stress or starvation condi- tions that still remain to be identified. The characterization of OsiS constitutes the starting point for the study of the basic mechanisms involving sulfur transfer in Anabaena, as well as other cyanobacteria in general because little is known so far about these mechanisms. Experimental procedures Bacterial strains, plasmids and growth conditions Anabaena sp. PCC 7120 was grown in BG11 medium at 30 °C in the air under continuous illumination (40 lEÆm )2 Æs )1 ). Cyanobacterial growth was monitored by measuring A 750 . E. coli BL21(DE3) (Novagen, Madison, WI, USA) cells grown in the LB medium were used to express the cysteine desulfurase OsiS and its mutant derivative OsiS C329S. The BHT101 E. coli [33] strain was used for the two-hybrid analyses. The E. coli DV1247 strain (DlacZ P iscR ::lacZ Discs DsufS::kan zdj-925::Tn10 MVA+) [42] was grown in LB medium supplemented with mevalonate (1 mm), chloramphe- nicol (25 lgÆmL )1 ) and tetracycline (25 lgÆmL )1 ). Arabinose (0.2%) and ampicilline (100 lgÆmL )1 ) were added when required. The expression of the osiS gene in E. coli strains was per- formed as following: a DNA fragment corresponding to the entire coding region of alr2505 was amplified by PCR using the Osi top primer 5¢- GAATTCATGTCTAATCGTCCTA- TATATC-3¢ (EcoRI site underlined) and the Osi bottom primer 5¢- GTCGACTACCAAAGTTGCTTGTT-3¢ (SalI site underlined). The PCR product was cloned into the pBAD24 plasmid [47]. After DNA sequencing analysis, recombinant plasmids were introduced in E. coli strains. osiS expression was induced using arabinose. Expression and purification of recombinant proteins A DNA fragment corresponding to the entire coding region of alr2505 was amplified by PCR using the Osi forward primer 5¢- GAATTCATGTCTAATCGTCCTATATATC-3¢ M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3721 (EcoRI site underlined) and the Osi reverse primer 5¢-CTC GAGTACCAAAGTTGCTTGTT-3¢ (XhoI site underlined). The PCR product was cloned into the pET22 vector (Novagen). A clone confirmed by DNA sequencing was grown in ampicillin-supplemented medium until A 600 of 0.3–0.4 was reached, and protein expression was induced by adding 1 mm isopropyl thio-b-d-galactoside for 4 h. After sonication, OsiS protein aggregated into inclusion bodies. Urea solubilization was performed using a final urea-con- centration of 6 m. The extracts were then dialyzed in a three-step experiment (3, 1 and 0 m urea) to eliminate urea. The recombinant proteins were purified using Hitrap columns in accordance with the manufacturer’s instructions (Amersham Pharmacia, Piscataway, NJ, USA). Imidazol was removed from purified proteins using PD10 columns (Amersham Pharmacia). Proteins were concentrated on Vivaspin columns (Sartorius, Gottingen, Germany) and used for subsequent analyses. Proteins were separated by SDS ⁄ PAGE (12.5% gel) and stained using the SeeBand procedure (Euromedex, Mundolsheim, France). Site-directed mutagenesis The mutation of the cysteine residue at position 329 of OsiS into a serine residue was performed by PCR using the megaprimer strategy [48]. The primers used were: forward mut primer 5¢- GAATTCATGTCTAATCGTCCTATATA TCTTGACT-3¢ (EcoRI site underlined), internal mut primer 5¢-TCCGCTTCTTCCTCCA-3¢ and reverse mut primer 5¢- CTCGAGTACCAAAGTTGCTTGTTT-3¢ ( XhoI site underlined). The PCR product was cloned into the vector pET22. Recombinant plasmids were confirmed by DNA sequencing. The mutant protein was expressed and purified using the same procedure as for the wild-type protein. E. coli two-hybrid assays To fuse the C- and N-terminals of OsiS to adenylate cyclase, the osiS gene was amplified by PCR using the primers OsiS-TH forward 5¢- CTC GAG CTA TAC CAA AGT TGC TT-3¢ (XhoI site underlined) and OsiS-TH reverse 5¢- GAA TTC ATG GTT CAA TTT ATC CCA-3¢ (EcoRI site underlined). The PCR fragments were cloned into the XhoI and EcoRI sites of vectors pT25-zip and pT18-zip [33]. BHT101 strain was co-transformed with the pT18- and pT25-based plasmids and incubated overnight at 30 °C in LB medium supplemented with 1 mm isopropyl thio-b-d-galactoside. b-galactosidase activity was assayed and expressed in Miller units [49]. Plasmids pT25 and pT18 were used as negative controls. Cysteine desulfurase assay The cysteine desulfurase activity was quantified by deter- mining the amount of alanine formed from l-cysteine (Sigma, St Louis, MO, USA). The standard reaction mix- ture in a final volume of 100 lL was: 25 mm Tris, pH 7.5, 100 mm NaCl, 10 mm dithiothreitol and 100 lm PLP. Final protein concentrations were 1 lm of OsiS or OsiSC329S. Reactions were initiated by adding variable concentrations of l-cysteine (final concentration in the range 0–250 lm) and allowed to continue for 3 h at 37 °C. Reactions were stopped by heating the mixtures at 99 °C for 10 min. Dena- tured proteins were removed by centrifugation, and the supernatant was analyzed to determine its alanine content by performing an alanine dehydrogenase assay [50]. The alanine content of assay mixtures was determined based on A 340 for NADH (e 340 nm = 6.2 mm )1 Æcm )1 ). The cysteine desulfurase activity is expressed in units corresponding to nmol alanineÆmin )1 Æmg protein )1 . Pyruvate was measured in 50 mm MOPS ⁄ KOH (pH 8) using 0.12 lmol NADH and 10 lg of lactate dehydroge- nase (Sigma) in a final volume of 0.5 mL. Oxidation of NADH was determined based on the decrease of A 340 . Apoferredoxin preparation and Fe-S cluster reconstitution The Fe-S cluster was incorporated into apoferredoxin using apoferredoxin from Spinach (Sigma) as substrate. Apoferre- doxin was obtained from holoferredoxin as described previ- ously [51]. The reconstitution experiment of the Fe-S cluster was carried out in 50 mm Tricine–NaOH (pH 7.5) containing 0.1 mml-cysteine, 2 mm Fe(NH 4 ) 2 (SO 4 ) 2 , 10 mm dithiothreitol, 0.1 mm PLP, 1 lm apoferredoxin and 1 lm of OsiS cysteine desulfurase. The proteins were han- dled under anaerobic conditions. Cysteine desulfurase activ- ity was measured as described above. Semi-quantitative RT-PCR experiments RNA was extracted as described previously [29]. One microgram of RNA was used in each RT-PCR experiment. Samples were collected at the exponential phase of the Table 2. Sequences of the primers used in the RT-PCR experiments. Gene Primers (5¢-to3¢) rnpB Forward: AGG GAG AGA GTA GGC GTT GC Reverse: GGT TTA CCG AGC CAG TAC CTC T isiA Forward: GCC CGC TTC GCC AAT CTC TC Reverse: CCT GAG TTG TTG CGT CGT TA alr2495 Forward: AAA ACG GCT GCA GTT CTC A Reverse: CCC AAT TGC AGG TGT ACC alr3088 Forward: GTT TTA GTT TCT GTT ATT TAC GGT CAA Reverse: TTC TCT GTC GCC GGT GGG GAT alr1457 Forward: AAT ATC GCC GTT AAC TTC GC Reverse: GCC TTG GTG ACA ATT ATG TA alr2505 Forward: GTT GCA ACA CAC CAA TTT CG Reverse: CAA GCA CGG GAA ATT TTA GC OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al. 3722 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works PCR. All RT-PCR experiments were repeated three times, and similar results were obtained consistently. The sequences of all the primers used in this experiment are listed in Table 2. Analytical methods Protein was assayed as described by Bradford [52], using BSA as the standard. Absorption spectra were recorded in a Varian Cary 50 Bio UV-visible spectrophotometer (Var- ian Inc., Palo Alto, CA, USA). The reaction mixtures con- tained 5 mgÆmL )1 OsiS. Equivalent mixtures without OsiS were used to record the respective baselines. Acknowledgements We are grateful to B. Py for valuable discussions. We thank the members of the Gudicci–Orticoni Labora- tory for their help with the anaerobic experiments. We thank Jessica Blanc for revising the English manu- script. This work was supported by an ‘Environnement et sante ´ ’ grant (AFSSE). References 1 Heidenreich T, Wollers S, Mendel RR & Bittner F (2005) Characterization of the NifS-like domain of ABA3 from Arabidopsis thaliana provides insight into the mechanism of molybdenum cofactor sulfuration. J Biol Chem 280, 4213–4218. 2 Marelja Z, Stocklein W, Nimtz M & Leimkuhler S (2008) A novel role for human Nfs1 in the cytoplasm: Nfs1 acts as a sulfur donor for MOCS3, a protein involved in molybdenum cofactor biosynthesis. J Biol Chem 283, 25178–25185. 3 Neumann M, Stocklein W, Walburger A, Magalon A & Leimkuhler S (2007) Identification of a Rhodobacter capsulatus L-cysteine desulfurase that sulfurates the molybdenum cofactor when bound to XdhC and before its insertion into xanthine dehydrogenase. Biochemistry 46, 9586–9595. 4 Mihara H, Hidese R, Yamane M, Kurihara T & Esaki N (2008) The iscS gene deficiency affects the expression of pyrimidine metabolism genes. Biochem Biophys Res Commun 372, 407–411. 5 Lauhon CT (2002) Requirement for IscS in biosynthesis of all thionucleosides in Escherichia coli. J Bacteriol 184, 6820–6829. 6 Leipuviene R, Qian Q & Bjork GR (2004) Formation of thiolated nucleosides present in tRNA from Salmonella enterica serovar Typhimurium occurs in two principally distinct pathways. J Bacteriol 186, 758–766. 7 Mihara H, Kato S, Lacourciere GM, Stadtman TC, Kennedy RA, Kurihara T, Tokumoto U, Takahashi Y & Esaki N (2002) The iscS gene is essential for the biosynthesis of 2-selenouridine in tRNA and the selenocysteine-containing formate dehydrogenase H. Proc Natl Acad Sci USA 99, 6679–6683. 8 Muhlenhoff U, Balk J, Richhardt N, Kaiser JT, Sipos K, Kispal G & Lill R (2004) Functional characteriza- tion of the eukaryotic cysteine desulfurase Nfs1p from Saccharomyces cerevisiae. J Biol Chem 279, 36906– 36915. 9 Nakai Y, Umeda N, Suzuki T, Nakai M, Hayashi H, Watanabe K & Kagamiyama H (2004) Yeast Nfs1p is involved in thio-modification of both mitochondrial and cytoplasmic tRNAs. J Biol Chem 279, 12363–12368. 10 Pilon-Smits EA, Garifullina GF, Abdel-Ghany S, Kato S, Mihara H, Hale KL, Burkhead JL, Esaki N, Kuriha- ra T & Pilon M (2002) Characterization of a NifS-like chloroplast protein from Arabidopsis. Implications for its role in sulfur and selenium metabolism. Plant Physiol 130, 1309–1318. 11 Schwartz CJ, Djaman O, Imlay JA & Kiley PJ (2000) The cysteine desulfurase, IscS, has a major role in in vivo Fe-S cluster formation in Escherichia coli. Proc Natl Acad Sci USA 97, 9009–9014. 12 Tokumoto U & Takahashi Y (2001) Genetic analysis of the isc operon in Escherichia coli involved in the biogen- esis of cellular iron-sulfur proteins. J Biochem 130, 63–71. 13 Van Hoewyk D, Abdel-Ghany SE, Cohu CM, Herbert SK, Kugrens P, Pilon M & Pilon-Smits EA (2007) Chloroplast iron-sulfur cluster protein maturation requires the essential cysteine desulfurase CpNifS. Proc Natl Acad Sci USA 104, 5686–5691. 14 Ye H, Garifullina GF, Abdel-Ghany SE, Zhang L, Pilon-Smits EA & Pilon M (2005) The chloroplast NifS-like protein of Arabidopsis thaliana is required for iron-sulfur cluster formation in ferredoxin. Planta 220, 602–608. 15 Zheng L, White RH, Cash VL, Jack RF & Dean DR (1993) Cysteine desulfurase activity indicates a role for NIFS in metallocluster biosynthesis. Proc Natl Acad Sci USA 90, 2754–2758. 16 Mihara H & Esaki N (2002) Bacterial cysteine desulfu- rases: their function and mechanisms. Appl Microbiol Biotechnol 60, 12–23. 17 Zheng L, White RH, Cash VL & Dean DR (1994) Mechanism for the desulfurization of L-cysteine cata- lyzed by the nifS gene product. Biochemistry 33, 4714– 4720. 18 Lima CD (2002) Analysis of the E. coli NifS CsdB pro- tein at 2.0 A reveals the structural basis for perselenide and persulfide intermediate formation. J Mol Biol 315, 1199–1208. 19 Outten FW, Wood MJ, Munoz FM & Storz G (2003) The SufE protein and the SufBCD complex enhance SufS cysteine desulfurase activity as part of a sulfur M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3723 transfer pathway for Fe-S cluster assembly in Escheri- chia coli. J Biol Chem 278, 45713–45719. 20 Loiseau L, Ollagnier-de Choudens S, Lascoux D, Forest E, Fontecave M & Barras F (2005) Analysis of the heteromeric CsdA-CsdE cysteine desulfurase, assisting Fe-S cluster biogenesis in Escherichia coli. J Biol Chem 280, 26760–26769. 21 Jaschkowitz K & Seidler A (2000) Role of a NifS-like protein from the cyanobacterium Synechocystis PCC 6803 in the maturation of FeS proteins. Biochemistry 39, 3416–3423. 22 Kato S, Mihara H, Kurihara T, Yoshimura T & Esaki N (2000) Gene cloning, purification, and characteriza- tion of two cyanobacterial NifS homologs driving iron- sulfur cluster formation. Biosci Biotechnol Biochem 64, 2412–2419. 23 Behshad E, Parkin SE & Bollinger JM Jr (2004) Mechanism of cysteine desulfurase Slr0387 from Synechocystis sp. PCC 6803: kinetic analysis of cleavage of the persulfide intermediate by chemical reductants. Biochemistry 43, 12220–12226. 24 Seidler A, Jaschkowitz K & Wollenberg M (2001) Incorporation of iron-sulphur clusters in membrane- bound proteins. Biochem Soc Trans 29, 418–421. 25 Tirupati B, Vey JL, Drennan CL & Bollinger JM Jr (2004) Kinetic and structural characterization of Slr0077 ⁄ SufS, the essential cysteine desulfurase from Synechocystis sp. PCC 6803. Biochemistry 43, 12210– 12219. 26 Kessler D (2004) Slr0077 of Synechocystis has cysteine desulfurase as well as cystine lyase activity. Biochem Biophys Res Commun 320, 571–577. 27 Kaneko T, Nakamura Y, Wolk CP, Kuritz T, Sasamoto S, Watanabe A, Iriguchi M, Ishikawa A, Kawashima K, Kimura T et al. (2001) Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120. DNA Res 8, 205–213. 28 Mulligan ME & Haselkorn R (1989) Nitrogen fixation (nif) genes of the cyanobacterium Anabaena species strain PCC 7120. The nifB-fdxN-nifS-nifU operon. J Biol Chem 264, 19200–19207. 29 Xu WL, Jeanjean R, Liu YD & Zhang CC (2003) pkn22 (alr2502) encoding a putative Ser ⁄ Thr kinase in the cyanobacterium Anabaena sp. PCC 7120 is induced by both iron starvation and oxidative stress and regulates the expression of isiA. FEBS Lett 553, 179–182. 30 Latifi A, Ruiz M, Jeanjean R & Zhang CC (2007) PrxQ-A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacterium Anabaena sp. strain PCC7120. Free Radic Biol Med 42, 424–431. 31 Kelley LA & Sternberg MJ (2009) Protein structure pre- diction on the Web: a case study using the Phyre server. Nat Protoc 4, 363–371. 32 Cupp-Vickery JR, Urbina H & Vickery LE (2003) Crys- tal structure of IscS, a cysteine desulfurase from Escher- ichia coli. J Mol Biol 330, 1049–1059. 33 Karimova G, Ullmann A & Ladant D (2000) A bacte- rial two-hybrid system that exploits a cAMP signaling cascade in Escherichia coli. Methods Enzymol 328, 59–73. 34 Loiseau L, Ollagnier-de-Choudens S, Nachin L, Fonte- cave M & Barras F (2003) Biogenesis of Fe-S cluster by the bacterial Suf system: SufS and SufE form a new type of cysteine desulfurase. J Biol Chem 278, 38352– 38359. 35 Mihara H, Kurihara T, Yoshimura T & Esaki N (2000) Kinetic and mutational studies of three NifS homologs from Escherichia coli: mechanistic difference between L-cysteine desulfurase and L-selenocysteine lyase reactions. J Biochem 127, 559–567. 36 Michel KP & Pistorius EK (2004) Adaptation of the photosynthetic electron transport chain in cyanobacteria to iron deficiency: the function of IdiA and IsiA. Physiol Plant 120, 36–50. 37 Latifi A, Jeanjean R, Lemeille S, Havaux M & Zhang CC (2005) Iron starvation leads to oxidative stress in Anabaena sp. strain PCC 7120. J Bacteriol 187, 6596– 6598. 38 Fontecave M, Choudens SO, Py B & Barras F (2005) Mechanisms of iron-sulfur cluster assembly: the SUF machinery. J Biol Inorg Chem 10, 713–721. 39 Fontecave M & Ollagnier-de-Choudens S (2008) Iron-sulfur cluster biosynthesis in bacteria: mechanisms of cluster assembly and transfer. Arch Biochem Biophys 474, 226–237. 40 Vinella D, Brochier-Armanet C, Loiseau L, Talla E & Barras F (2009) Iron-sulfur (Fe ⁄ S) protein biogenesis: phylogenomic and genetic studies of A-type carriers. PLoS Genet 5, e1000497. 41 Layer G, Gaddam SA, Ayala-Castro CN, Ollagnier-de Choudens S, Lascoux D, Fontecave M & Outten FW (2007) SufE transfers sulfur from SufS to SufB for iron-sulfur cluster assembly. J Biol Chem 282, 13342– 13350. 42 Trotter V, Vinella D, Loiseau L, Ollagnier de Choudens S, Fontecave M & Barras F (2009) The CsdA cysteine desulphurase promotes Fe ⁄ S biogenesis by recruiting Suf components and participates to a new sulphur transfer pathway by recruiting CsdL (ex-YgdL), a ubiquitin-modifying-like protein. Mol Microbiol 74, 1527–1542. 43 Schwartz CJ, Giel JL, Patschkowski T, Luther C, Ruzicka FJ, Beinert H & Kiley PJ (2001) IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins. Proc Natl Acad Sci USA 98, 14895–14900. 44 Yeo WS, Lee JH, Lee KC & Roe JH (2006) IscR acts as an activator in response to oxidative stress for the OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al. 3724 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works [...]... et al 45 46 47 48 suf operon encoding Fe-S assembly proteins Mol Microbiol 61, 206–218 Mihara H, Kurihara T, Yoshimura T, Soda K & Esaki N (1997) Cysteine sulfinate desulfinase, a NIFS-like protein of Escherichia coli with selenocysteine lyase and cysteine desulfurase activities Gene cloning, purification, and characterization of a novel pyridoxal enzyme J Biol Chem 272, 22417–22424 Imlay JA (2003) Pathways... Pathways of oxidative damage Annu Rev Microbiol 57, 395–418 Guzman LM, Belin D, Carson MJ & Beckwith J (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter J Bacteriol 177, 4121–4130 Wu W, Jia Z, Liu P, Xie Z & Wei Q (2005) A novel PCR strategy for high-efficiency, automated site-directed mutagenesis Nucleic Acids Res 33, e110 OsiS: oxidative stress -induced. .. 4762–4771 52 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 53 Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC & Ferrin TE (2004) UCSF Chimera – a visualization system for exploratory research and analysis J Comput Chem 25, 1605–1612 FEBS Journal 277 (2010)... oxidative stress -induced cysteine desulfurase 49 Miller JH (1972) Experiments in Molecular Genetics Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 50 Yoshida A & Freese E (1975) Lactate dehydrogenase from Bacillus subtilis Methods Enzymol 41, 304–309 51 Moulis JM & Meyer J (1982) Characterization of the selenium-substituted 2 [4Fe-4Se] ferredoxin from Clostridium pasteurianum Biochemistry... Greenblatt DM, Meng EC & Ferrin TE (2004) UCSF Chimera – a visualization system for exploratory research and analysis J Comput Chem 25, 1605–1612 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS No claim to original French government works 3725 . The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress Marion Ruiz, Azzeddine Bettache, Annick. biogenesis path- ways or also to other sulfur-using biosynthetic path- ways in Anabaena remains unanswered. On the basis of the data obtained for the Anabaena genome