Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx
Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx
... TTG GTG ACA ATT ATG TA alr2505 Forward: GTT GCA ACA CAC CAA TTT CG Reverse: CAA GCA CGG GAA ATT TTA GC OsiS: oxidative stress -induced cysteine desulfurase M. Ruiz et al. 3722 FEBS Journal 277 ... Latifi A, Ruiz M, Jeanjean R & Zhang CC (2007) PrxQ -A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacteriu...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx
... 5¢-AGC TTGTCGACGTTAATGAGCCGCAGCAGTTCCC-3¢; mtl-2_fwd: 5¢-TATACATATGGTCTGCAAGTGTGACT GC-3¢ and mtl-2_rev: 5¢-AGCTTGTCGACGTTAATGA GCAGCCTGAGCACAT-3¢), generating DNA fragments of 247 and 211 bp for isoform 1 and ... fitted Zn and Cd XANES and EXAFS data have previously illustrated that isolated mammalian metallothioneins bind metals [37,38], the data presented here reveal that the MT status...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf
... n M AG1478. Lysates were prepared at the indicated time points after the AG1478 addition and analyzed for caspase 3 activity by using a fluorometric substrate-based assay. Each point is the mean ... treated with 500 n M AG1478. Lysates were prepared at the indicated time points after the AG1478 addition and analyzed for caspase 3 activ- ity by using a fluorometric substrate-ba...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... determination of the phytase gene Strain HJB17 was cultured in Luria–Bertani medium at 37 °C overnight and genomic DNA was extracted using the TIANamp Bact...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... SJ, Ward ER, Ryals JA & Dangl JL (1994) Arabidopsis mutants simulating disease resistance response. Cell 77, 565–577. 26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K, Miyao A, Kawasaki T, ... artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinase assay visualized by autoradiography and the bottom pan...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... Clair S, Giono L, Varmeh-Ziaie S, Resnick-Silver- man L, Liu WJ, Padi A, Dastidar J, DaCosta A, Mattia M & Manfredi JJ (2004) DNA damage -induced down- regulation of Cdc25C is mediated by ... immunoprecipitations and can activate tran- scription of the promoter in transient transfection assays through the upstream part of the SIRF element. Mutational analysis of a putative CD...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... reagents and the recombinant human TRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitor substrate ... antibody against GFP was purchased from Invitrogen (Carlsbad, CA, USA). The monoclonal antibody against phospho-SAPK ⁄ JNK (T183 ⁄ Y185) was purchased from GenScript (Pi...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc
... anti-flag WB anti-HA TIAR-flag BOIP-flag HA-hnRNP M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnRNP M HA-DDX21 Fig. ... (HA)-tagged candidates in 293T cells and Flag-IP products were analyzed by western blot analysis with anti-Flag and anti-HA sera. The specific- ity of the interactions was evalua...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx
... B, Baratto MC, Sinicropi A, Giardina P, Pezzella C, Sannia G & Basosi R (2007) Evidence for a radical mechanism in biocatalytic degradation of synthetic dyes by fungal laccases mediated by ... Pereira L, Coelho AV, Viegas CA, Ganachaud C, Iacazio G, Tron T, Robalo MP & Martins LO (2009) On the mechanism of biotransformation of the anthraquinonic dye blue 62 by laccases....
Ngày tải lên: 18/02/2014, 04:20