0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

... TTG GTG ACA ATT ATG TA alr2505 Forward: GTT GCA ACA CAC CAA TTT CGReverse: CAA GCA CGG GAA ATT TTA GCOsiS: oxidative stress -induced cysteine desulfurase M. Ruiz et al.3722 FEBS Journal 277 ... Latifi A, Ruiz M, Jeanjean R & Zhang CC (2007)PrxQ -A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacterium Anabaena sp. strain ... with Anabaena genomic DNA as the template, at the same annealing temperatures as those used in the RT-PCR experiments. (B) Organization of cysteine desulfurase- encoding genes in Anabaena genome....
  • 11
  • 728
  • 0
Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx

Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx

... 5¢-AGCTTGTCGACGTTAATGAGCCGCAGCAGTTCCC-3¢;mtl-2_fwd: 5¢-TATACATATGGTCTGCAAGTGTGACTGC-3¢ and mtl-2_rev: 5¢-AGCTTGTCGACGTTAATGAGCAGCCTGAGCACAT-3¢), generating DNA fragmentsof 247 and 211 bp for isoform 1 and ... fitted Zn and Cd XANES andEXAFS data have previously illustrated that isolatedmammalian metallothioneins bind metals [37,38], the data presented here reveal that the MT status of the nematode does ... 9660Normalised signal A BFig. 3. Metal speciation in Caenorhabditis elegans strains. Compari-son of Cd XANES spectra (A) and Zn XANES spectra (B) obtained forC. elegans wild-type and metallothionein...
  • 12
  • 611
  • 0
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

... nM AG1478. Lysates were prepared at the indicated time points after the AG1478 addition and analyzed forcaspase 3 activity by using a fluorometric substrate-based assay.Each point is the mean ... treatedwith 500 nM AG1478. Lysates were prepared at the indicated timepoints after the AG1478 addition and analyzed for caspase 3 activ-ity by using a fluorometric substrate-based assay. Each ... substrate-based assay. Each point is the mean of the triplicate samples, and the bar represents the standarddeviation. Similar results were obtained from three separate experi-ments.JNK activation...
  • 11
  • 659
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... wasdetermined using the Bradford assay with BSA as the standard [28].Phytase activity assayPhytase activity was determined by measuring the amountof phosphate released from InsP6using a modified ferroussulfate ... determination of the phytase gene Strain HJB17 was cultured in Luria–Bertani medium at37 °C overnight and genomic DNA was extracted using the TIANamp Bacteria DNA kit (Tiangen, Beijing, China). The ... phytase andpurple acid phosphatase) by having a neutral (pH7.0) rather than acidic pH optimum. Previous studieshave shown that BPP is the major class of phytate-degrading enzyme in nature,...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... SJ, Ward ER, RyalsJA & Dangl JL (1994) Arabidopsis mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,Miyao A, Kawasaki T, ... artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and the bottom panel shows the ... OXI1 (At3g25250) or PTI1-4(At2g47060) was cloned in the pBD-GAL4 cam (Stratagene,La Jolla, CA, USA) and were each used as bait to screen anArabidopsis pACT2 cDNA library [36]. The yeast strain PJ69-4A...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... Clair S, Giono L, Varmeh-Ziaie S, Resnick-Silver-man L, Liu WJ, Padi A, Dastidar J, DaCosta A, MattiaM & Manfredi JJ (2004) DNA damage -induced down-regulation of Cdc25C is mediated by ... immunoprecipitations and can activate tran-scription of the promoter in transient transfectionassays through the upstream part of the SIRF element.Mutational analysis of a putative CDE ⁄ CHR site in the ... on the same side of the DNA.Conservation of spacing is required for optimal pro-moter activity because changing the distance leads to a loss of activation [58].One reason for the specific spacing...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... reagents and the recombinant humanTRAIL ⁄ APO 2 ligand were purchased from Invitrogen andFeldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitorsubstrate ... antibody against GFPwas purchased from Invitrogen (Carlsbad, CA, USA). The monoclonal antibody against phospho-SAPK ⁄ JNK(T183 ⁄ Y185) was purchased from GenScript (Piscataway,NJ, USA). MTT reagents ... cytochrome c and second mitochondria-derivedactivator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell [18,19].In...
  • 12
  • 718
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)SJS138 TACGAGATCTTAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)SJS172 GGGATCATGCCCAAGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)SJS173 AGTAAGGAAAATAAGCTTGGGCATGATCCC Reverse ... GACCCCTTCATTGACCTCAACTA Forward (nt 163–185 GAPDH)SJS209 CTTGATTTTGGAGGGATCTC Reverse (nt 318–299 GAPDH)SJS275 TTAGCTACATTAAATAGGCAG Reverse (nt 1620–1601 PAI-2)SJS276 GtaatacgactcactataGGGATCATGCCCATTTAG...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc

... anti-flagWB anti-HATIAR-flagBOIP-flagHA-hnRNP MRNaseAWB anti-flagWB anti-HAHA TIAR Merged DAPITIAR-flagBOIP-flagHA-DDX21RNaseAWB anti-flagWB anti-HABHA-ASF/SF2HA-p68HA-hnRNP MHA-DDX21Fig. ... (HA)-tagged candidates in 293T cellsand Flag-IP products were analyzed by western blotanalysis with anti-Flag and anti-HA sera. The specific-ity of the interactions was evaluated by IP of the ... anti-TIARTIAR-TAPTIAR-CBPTIARTA PTA PTIAR-TAP6 6A 767–++RT-PCRWB anti-TIARTIAR-TAPTIARCBFig. 1. Functional characterization of TIAR-TAP protein and purification of TIAR-TAP complexes....
  • 19
  • 666
  • 0
Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

... B, Baratto MC, Sinicropi A, Giardina P, Pezzella C, Sannia G & Basosi R (2007)Evidence for a radical mechanism in biocatalyticdegradation of synthetic dyes by fungal laccasesmediated by ... Pereira L, Coelho AV, Viegas CA, Ganachaud C,Iacazio G, Tron T, Robalo MP & Martins LO (2009)On the mechanism of biotransformation of the anthraquinonic dye blue 62 by laccases. Adv SynthCatal ... is a robust catalyst, although to a lower extentthan McoA from A. aeolicus [5] and the laccase from T. thermophilus [32]. The first-order deactivationkinetics can be described by the classical...
  • 14
  • 642
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP