forces receptor ligand leverage and a new role for stress fibers
RBF Neurals Networks and a new algorithm for training RBF networks
... D.S Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks”, Complex Systems, vol 2, 1988, pp 321-355 J.Park and I.W Sandberg “Approximation and radial-basis-function ... California from the 1990 Cens us In this sample a block group on average includes 1425.5 individuals living in a geographically compact area Naturally, the geographical area included varies inversely ... Approx (1986), pp 11–22 17 M H Mousoun, Fundamental of Artificial Neural Networks, MIT Press, Cambridge, MA, 1995 22 G E Fasshauer and Jack G Zhang, “On Choosing “Optimal” Shape Parameters for...
- 22
- 270
- 0
Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf
... microRNAs can act as a trans-acting element for reversible and dynamic regulation of spatial and temporal protein expression Computational tools for discovery of microRNA and their targets Computational ... important as siRNA based therapeutics for viral pathogens in different stages of clinical trials and are showing promising results Artificial microRNAs (amiRNAs) and microRNA engineering MicroRNAs ... in latency and oncogenic transformation mediated by viruses Acknowledgements The authors thank Dr Elayanambi Sundaramoorthy for reviewing the manuscript and providing valuable suggestions Authors...
- 9
- 340
- 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...
- 144
- 306
- 0
Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps
... acquire data and contributed to the study design, statistical and data analysis, interpretation of data, and drafting of the manuscript SV, BTvdB, and MBB helped to acquire data JG, SA-R, and FAvdL ... statistical and data analysis, interpretation of data, and drafting of the manuscript WBvdB conceived of the study and helped draft the manuscript All authors read and approved the final manuscript ... in fore and hind paws was monitored at indicated time points and scored for severity (c) Histological analysis of inflammation ('infiltrate' and 'exudate') and proteoglycan depletion in patellar...
- 11
- 319
- 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model
... Chapter Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied when necessary for comparisons ... regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest...
- 80
- 424
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...
- 11
- 715
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
A New Vision for Adolescent Sexual and Reproductive Health pot
... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... methods than are their American peers As noted, they are less likely to be poor and they have greater access to sexual and reproductive health care services Dutch policy makers and health care providers,...
- 7
- 662
- 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive ... 119–128 24 Zhang T, Maekawa Y, Hanba J, Dainichi T, Nashed BF, Hisaeda H, Sakai T, Asao T, Himeno K, Good RA & Katunuma N (2000) Lysosomal cathepsin B plays an important role in antigen processing,...
- 12
- 645
- 0
Food and health in Europe: a new basis for action pdf
... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech ... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark...
- 38
- 334
- 0
Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt
... dedicated funding streams and annual appropriations NASA (an IGA) receives annual appropriations In the case of annual appropriations, the Senate and House will be required to authorize and appropriate ... standards for research quality and objectivity Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials Lynn E Davis, Debra Knopman, ... M&O management and operations MDO management and disposition organization MDWG Management and Disposition Working Group MRS monitored retrievable storage NASA National Aeronautics and Space Administration...
- 132
- 357
- 0
Food and health in Europe: a new basis for action pptx
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... tropical-plant fat and oil, are also strong stimulators for raising LDL levels, as are some transfatty acids (49) A major saturated fat, stearic acid, present in beef fat and lard, a 300 Men 200 100 Deaths...
- 405
- 635
- 0
Đề tài " Analytic representation of functions and a new quasianalyticity threshold " doc
... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... whereas the usual quasi-analyticity is placed near the “right end” in the scale of smoothness connecting C ∞ and analyticity, this 1036 GADY KOZMA AND ALEXANDER OLEVSKI˘ ı new quasi-analyticity threshold ... singular points of the boundary was investigated for F from the Nevanlinna class; see Shapiro [S66], Shamoyan [S95] and Bourhim, El-Fallah and Kellay [BEK04] In particular, applying theorem A of...
- 33
- 293
- 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
... include: Australia, Bangladesh, Yemen (3 each); Republic of Korea (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, ... bioinformatics, and public health B Research: to expand and increase collaborative global and local research initiatives especially on topics of public health importance such as obesity and motor ... make Qatar a leader in innovative education and research.” Under the leadership of His Highness Sheikh Hamad Bin Khalifa Al-Thani, the Emir of Qatar and founder of Qatar Foundation, and Her Highness...
- 8
- 375
- 0
Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx
... Statistical Analyses Part One Functional Movement Screen Data was coded using Stata 8.0 For exploratory data analysis we used bivariate methods The primary hypothesis was assessed with multivariate analysis ... fire department database, and other selected parameters (age, gender, tenure and rank) http://www.occup-med.com/content/2/1/3 icine physician, therapist, and fire department health and safety officer) ... activities and were on a full duty status Age at time of the study ranged from 21 to 60 years with a mean of 41.8 years for males and 37.4 years for females The subjects were 408 male (94.2 percent) and...
- 9
- 468
- 0
Báo cáo hóa học: " Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease" pot
... Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Brasília – DF Brasília – DF Acreuna – GO Presidente Olegário -MG Holambra – SP Primavera Leste – MT Primavera Leste – MT Primavera Leste ... design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements We thank Dr Carlos Eduardo Guerra Schrago and Dr Marcelo Soares from ... Location1 Cotton sp Cultivar Isolate Date Symptom2 Nested PCR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Sta Helena de Goiás – GO Piracicaba – SP Piracicaba – SP Piracicaba...
- 13
- 386
- 0
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc
... include: Australia, Bangladesh, Yemen (3 each); Republic of Korea (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, ... bioinformatics, and public health B Research: to expand and increase collaborative global and local research initiatives especially on topics of public health importance such as obesity and motor ... make Qatar a leader in innovative education and research.” Under the leadership of His Highness Sheikh Hamad Bin Khalifa Al-Thani, the Emir of Qatar and founder of Qatar Foundation, and Her Highness...
- 8
- 494
- 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
... increased collaboration and integration of TB and HIV programs and services at both national and local levels New Ways of Delivering Integrated Care With Nontraditional Healthcare Providers A critically ... 196:S63-S75 Abstract Gasana M, Vandebriel G, Kabanda G, et al.: Tuberculosis in Rwanda: challenges to reaching the targets Bull WHO 2007, 85:383-384 International epidemiologic databases to evaluate AIDS: ... collaboration between HIV and TB programs and integrating services is underway The World Health Organization (WHO) has formulated recommendations regarding collaboration and integration and has...
- 5
- 469
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access A new instrument for ppt
... develop and validate a scale that could be administered to anticoagulation patients generally; that is, across indication for anticoagulation and across models of anticoagulation management This ... development and validation is by no means a one-time event, efforts at assessing and improving the DASS are ongoing List of abbreviations DASS Duke Anticoagulation Satisfaction Scale PSQ-18 Satisfaction ... the hassle of the daily anti-coagulation related tasks had a rotated factor loading of 0.60 onto "hassles" and 0.51 onto "limitations" The variance explained by the hassles, limitations and positive...
- 11
- 361
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25