finally test makers should be informed of a detailed marking scale with specific rounding rules especially for subjective marking like translation and writing
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... Vitoloi S Brassica Carinata as an alternative oil crop for the production of biodiesel in Italy: engine performance and regulated and unregulated exhaust emissions Environmental Science and Technology...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...
- 16
- 646
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer ... coding for a putative mitochondrial preprotein of 501 amino acids with a calculated molecular weight of 57.7 kDa (Fig 2) After Leu24 a cleavage site for the matrix-associated protease was predicted...
- 9
- 671
- 0
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf
... They are generally called ADAMs (a disintegrin -like and metalloproteinase domain) with the same central catalytic domain as SVMPs and MMPs, especially at the active-site structure [21,22] A well ... make a favorable insertion and a precise stacking with the TACE active site Our work along this line may be helpful to form a firm basis for the rational design of inhibitors against TACE-related ... ultrafiltration and concentration was obtained from Millipore (Amicon bioseparation, Bedford, MA, USA) Preparation of inhibitor analogues and proteinase inhibition assays Inhibitor analogues were synthesized...
- 10
- 475
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps ... makes an angle of π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ... combinatorially compatible with the standard renormalization of critical circle maps, and fulfills some of the geometric estimates we need For example, [Ya] and [YZ] give asymptotically universal...
- 53
- 383
- 0
Optimal Design of a Hybrid Electric Car with Solar Cells pptx
... reliability of panels in case of lateral impacts) APV ,V ,MAX = (2l + w )(h − 0.9 ) − 0.1 w l FIG - SIMPLIFIED SCHEME OF SOLAR CAR (LATERAL AND REAR VIEW) The maximum panel area can be estimated as function ... solar panels It exhibit a payback of 3.13 years The addition of and m2 of solar panels (cases 2-3) increases solar fraction up to 30% but also payback to 8.7 years, since the greater daily saving ... respect to actual cars This result has been obtained with commercial PV panels and with realistic data and assumptions on the achievable net solar energy for propulsion The future adoption of last generation...
- 12
- 600
- 0
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx
... medication up to and including Day1 If fewer than scores are available then baseline consists of all scores that are available Page of (page number not for citation purposes) Health and Quality of ... Standard Deviation a Total number of tender points with value >0 at randomization; the number is missing if any of 18 tender points is missing b Baseline = Last available pain scores before taking ... correlation with MOS Quantity of Sleep; a modest correlation with MOS Sleep Adequacy; a small correlation with MOS Somnolence and MOS Awaken Short of Breath or with Headache; and no correlation with...
- 7
- 597
- 0
báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx
... to accommodate patients with different levels of impairments, 3) provides unilateral and bilateral training and 4) combines training of the hand and arm into an integrated task-based simulation ... rate at which task parameters change may affect the rate at which a particular subject learned to perform a task The algorithm experiment also suggests that the rate of task parameter change may ... unilaterally or bilaterally and combine proximal and distal training into a single activity or train each segment separately Additionally, it presents information regarding the variability among...
- 10
- 506
- 0
báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf
... same tasks - cash withdrawals and money transfers - with the VR-ATM or the real ATM in a rehabilitation hospital For the real ATM practice, the therapist issued the participant an ATM card, a ... They practiced and learned to use the VR-ATM through tasks such as inserting a debit card, withdrawing cash, and entering a password The amount of cash to be withdrawn or transferred varied randomly ... collected and analyzed data for Part II KNKF, CKKY and WAKY drafted the manuscript All authors read and approved the final manuscript Acknowledgements Presented in part at the Hospital Authority...
- 9
- 454
- 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, ... femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining ... as positive In accordance with a previous study [18], the size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro,...
- 10
- 478
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of ... and treatment J Oral Pathol Med 1994, 23:12-16 Hashimoto J, Ohno I, Nakatsuka K, Yoshimura N, Takata S, Zamma M, Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's ... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and...
- 4
- 402
- 0
báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf
... scale would have negative correlation with the GAD-7, SDS and PHQ-8 scales All statistical significance was set at a p value of less than 0.05 Vaingankar et al Health and Quality of Life Outcomes ... Resilience Scale for Adults; SDS: Sheehan Disability Scale; SWEMWBS: Short Warwick- Edinburg Mental Well-being Scale; SWLS: Satisfaction with Life Scale Vaingankar et al Health and Quality of Life ... Confirmatory Factor Analysis; DSES:Daily Spirituality Experience Scale; EFA:Exploratory Factor Analysis; EQ5D VAS: Euro-Quality of Life Scale Visual Analogue Scale; GAD-7:General Anxiety Disorder Scale; ...
- 18
- 487
- 0
báo cáo hóa học:" Psychometric evaluation of a visual analog scale for the assessment of anxiety" pdf
... (screening, baseline, and Weeks 1, 2, and 4) and are displayed in Table The correlations are generally smaller at screening and baseline and increase at later time-points with treatment As anticipated, ... correlations with the HAM -A, HADS-Anxiety, and the mental subscales of the SF-36, and lower correlations with the HADSDepression and the physical subscales of the SF-36 At Weeks 1, 2, and 4, all observed ... manuscript RJM and DF conceived of the study and participated in its design and analysis, and drafted major portions of the manuscript All authors read and approved the final manuscript Acknowledgements...
- 8
- 385
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics ... for i ∈ M } and J = { (a1 , ,an ) ∈ Kn : = for i ∈ L} References [1] D H Hyers, G Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
- 3
- 216
- 0
Báo cáo hóa học: "OSCILLATION OF A LOGISTIC DIFFERENCE EQUATION WITH SEVERAL DELAYS" ppt
... Israel E-mail address: brznsky@cs.bgu.ac.il E Braverman: Department of Mathematics and Statistics, University of Calgary, 2500 University Drive N.W., Calgary, Alberta T2N 1N4, Canada E-mail address: ... [1] R P Agarwal, S R Grace, and D O’Regan, Oscillation Theory for Difference and Functional Differential Equations, Kluwer Academic, Dordrecht, 2000 [2] R P Agarwal and P J Y Wong, Advanced Topics ... equation with several delays, Applied Mathematics and Computation 147 (2004), no 2, 515–525 [15] J R Yan and C X Qian, Oscillation and comparison results for delay difference equations, Journal of...
- 12
- 291
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. II. Daily actual evapotranspiration and soil water reserve" potx
... leaf area development For periods of leaf area expansion and leaf fall, daily transpiration was calculated with an equation based on daily PET and on a relative LAI (LAIi/LAImax), with i standing ... for maple, given in Mathieu [24] Table I summarises each plot’s basal area, LAI and SA for the years and for each type of species Total LAI was estimated from litter Evapotranspiration in a declining ... 616 C Vincke et al Table I For each year and each plot (Th.: Thinned; C.: Control): (a) basal area (G, m2 ha–1), LAI and sapwood area (SA, m2 ha–1) of pedunculate oak, maple, ring- and diffuse porous...
- 9
- 319
- 0
Báo cáo lâm nghiệp: "Growth of a poplar short rotation coppice under elevated atmospheric CO2 concentrations (EUROFACE) depends on fertilization and species" ppt
... regression analysis between basal area and total leaf area of each harvested shoot, was used to calculate leaf area for each shoot in a PGP Summarized for each stool, the leaf area was averaged over a ... (square) and unfertilized (circle) treatments Values are means ± SE (n = 3) for P alba, P nigra and P × euramericana The ANOVA results are shown in Tables II and III Table II Analysis of variance ... Telford, UK) The height of a stool was determined with an extendable pole as the height of the tallest shoot of the stool The basal area (BA) of each shoot, and the sum of basal areas (Σ BA) for...
- 9
- 287
- 0
Báo cáo khoa học: "Case of a sigmoid colon cancer with metachronous metastases to the mesorectum and the abdominal wall" pdf
... free of metastatic adenocarcinoma The patient had an uneventful recovery On rectum examination one year later a palpable extramucosal mass was noticed at the anterior rectum wall An abdominal CT ... Case of a sigmoid colon cancer with metachronous metastases of the stomach and the abdominal wall Nippon Shokakibyo Gakkai Zasshi 2009, 106(5):653-9 Kalaitzis et al World Journal of Surgical Oncology ... survival and it seems to increase as the primary tumor stage advance In this case, a sigmoid adenocarcinoma is infiltrating 2/3 of muscularis propria with four lymph nodes harvested free of metastatic...
- 4
- 463
- 0
Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx
... 2.2 BAC vector preparation pBeloBAC11 was kindly provided by H Shizuya, Department of Biology, California Institute of Technology (Pasadena, Calif.) Preparation of pBeloBAC11 was carried out as ... Schibler L., Vaiman D., Oustry A. , Guinec N., Dangy-Caye A. L., Billault A. , Cribiu E.P., Construction and extensive characterization of a goat bacterial articial chromosome library with threefold ... DNA inserts with an acceptable genomic delity in a bacterial articial chromosome (BAC) library to obtain complete coverage of the genome In addition to increased clone delity and a low level of...
- 6
- 271
- 0
Báo cáo y học: " Reliability and predictive validity of a hepatitisrelated symptom inventory in HIV-infected individuals referred for Hepatitis C treatment." docx
... California at San Diego 200 West Arbor Drive, San Diego, California 92103 USA 2Department of Pharmacy, University of California at San Diego 200 West Arbor Drive, San Diego, California 92103 USA ... determination regarding scale inclusion of items was based on factor loadings and investigator judgment regarding content and face validity for a putative subscale construct (Table 1) Internal consistency ... Terrault NA, Wiley-Lucas TE, Afdhal N, Brown RS, Belle SH, Hoofnagle JH, Kleiner DE, Howell CD, Virahep-C Study Group: Peginterferon and ribavirin treatment in African American and Caucasian American...
- 9
- 483
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008