fat stem cells jeffrey m gimble bruce a bunnell and farshid guilak
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... MS, Elnekave E, Mentink-Kane MM, Hodges MG, Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A et al (2007) IL-13Ralpha2 and IL-10 coordinately suppress airway inflammation,...
- 11
- 653
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... Mesenchymal–epithelial transition during somatic segmentation is regulated by differential roles of Cdc42 and Rac1 Dev Cell 7, 425–438 33 Hatada I, Fukasawa M, Kimura M, Morita S, Yamada K, Yoshikawa T, Yamanaka ... grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, Tokyo, Japan) containing 41 ... Yamamoto H, Aoyagi K, Sasaki H, Asari A, Quinn G, Terada M & Ochiya T (2005) Direct hepatic fate specification from mouse embryonic stem cells Hepatology 41, 836–846 Banas A, Teratani T, Yamamoto Y,...
- 14
- 597
- 0
báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc
... condition A horizontal incision was made to expose the main stem of the facial nerve A segment of mm was removed A nerve gap defect of approximately mm was apparent after contraction A conduit of mm ... for visualization Statistics analysis Means and standard error of the mean (SEM) were calculated The one-way analysis of variance (ANOVA) was applied to analyze continuous variables: time latency, ... ubiquitous and are major components of extracellular matrix (ECM) in the mammalian body HA has a high capacity for holding water and possesses a high visco-elasticity It adheres poorly to cells and...
- 11
- 1,027
- 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... ischemia? J Transl Med 2008, 6:45 Hida N, Nishiyama N, Miyoshi S, Kira S, Segawa K, Uyama T, Mori T, Miyado K, Ikegami Y, Cui C, Kiyono T, Kyo S, Shimizu T, Okano T, Sakamoto M, Ogawa S, Umezawa A: ... da Silva Meirelles L, Caplan AI, Nardi NB: In search of the in vivo identity of mesenchymal stem cells Stem Cells 2008, 26:2287-2299 Krampera M, Marconi S, Pasini A, Galiè M, Rigotti G, Mosna ... 72:252-254 Secco M, Zucconi E, Vieira NM, Foga a LL, Cerqueira A, Carvalho MD, Jazedje T, Okamoto OK, Muotri AR, Zatz M: Mesenchymal stem cells from umbilical cord: not discard the cord! Neuromuscul Disord...
- 10
- 456
- 0
Báo cáo sinh học: "Autologous Transplantation of Adipose-Derived Mesenchymal Stem Cells Markedly Reduced Acute Ischemia-Reperfusion Lung Injury in a Rodent Model" potx
... USA) and heme oxygense (HO)-1 (1: 250, Abcam, Cambridge, MA, USA), and polyclonal antibodies against TNF -a (1: 1000, Cell Signaling, Danvers, MA, USA) and NFB (1: 250, Abcam, Cambridge, MA, USA) ... incubated with monoclonal antibodies against vascular cell adhesion molecule (VCAM)-1 (1: 100, Abcam, Cambridge, MA, USA), intercellular adhesion molecule (ICAM)-1 (1: 2000, Abcam, Cambridge, MA, ... in rats J Transl Med 2010, 8:63 29 Banas A, Teratani T, Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M, Kato T, Okochi H, Ochiya T: IFATS collection: in vivo therapeutic potential of...
- 13
- 280
- 0
báo cáo hóa học:"Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS?" pot
... general and in the non-caucasoid populations in particular C M ller illustrated this fact with data from the German National Bone Marrow Donor Registry (ZKRD, Ulm, Germany): a simulation study based ... 4/6 HLA matches at HLA A, B and DR with Class I matches, which would remarkably increase the probability of finding a matching donor with CCR5-delta32 homozygosity C Navarrete (British Bone Marrow ... CCR5-positive macrophages were detected five months after transplantation Although complete chimerism of the myeloid lineage had not been reached at this time, viral rebound was not observed Mucosal macrophages...
- 5
- 206
- 0
Báo cáo khoa học: "Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury" potx
... medium with 10% FBS, 10 μg/mL insulin (Sigma-Aldrich, USA), M dexamethasone (Sigma-Aldrich, USA), 0.2 mM indomethacin (SigmaAldrich, USA), and 0.5 mM isobutylmethylxanthine (SigmaAldrich, USA)] ... osteogenic medium [DMEM low-glucose medium with 10% FBS, 0.1 M dexamethasone (Sigma-Aldrich, USA), 50 M l-Ascorbate2-phosphate (Sigma-Aldrich, USA), and 10 mM betaglycerophosphate (Sigma-Aldrich, USA)] ... IV administration of propofol (Ha Na Pharm, Korea) at mg/kg Anesthesia was maintained by 2% isoflurane (Ilisung, Korea) in oxygen The minimum alveolar concentration was about 1.5 A multiparameter...
- 12
- 309
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... Gritzapis AD, Baxevanis CN, Papamichail M: Interactions between human mesenchymal stem cells and natural killer cells Stem Cells 2006, 24:74-85 Available online http://arthritis-research.com/content/9/1/301 ... MSC, mesenchymal stem cell (multipotent mesenchymal stromal cell); TGF, transforming growth factor Table Proposed mechanisms of antiproliferative and immunomodulatory effects of MSCs Mechanism Model ... SE, Markham AF, Emery P, McGonagle D: Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis Arthritis...
- 10
- 559
- 0
Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps
... 5'-GGTGGCAGAACTTGAAGGGTTA-3' (forward) and 5'-GGGCAACACACACAGGAAATC-3' (reverse); L-SOX5, 5'-GAATGTGATGGGACTGCTTATGTAGA-3' (forward) and 5'-GCATTTATTTGTACAGGCCCTACAA-3' (reverse); SOX6, 5'CACCAGATATCGACAGAGTGGTCTT-3' ... 5'CGGTTTGCCAGGAGCTATAGG-3' (forward) and 5'TCTCGGCCATTTTTCCCATA-3' (reverse); COL1 0A1 , 5'TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAGTACAGTGCATAAATAAATAATATATCTCCA-3' (reverse); COL1 1A2 , 5'-CCTGAGCCACTGAGTATGTTCATT-3' ... 5'CACCAGATATCGACAGAGTGGTCTT-3' (forward) and 5'CAGGGTTAAAGGCAAAGGGATAA-3' (reverse); SOX9, 5'CTTTGGTTTGTGTTCGTGTTTTG-3' (forward) and 5'-AGAGAAAGAAAAAGGGAAAGGTAAGTTT-3' (reverse); versican, 5'-TGCTAAAGGCTGCGAATGG-3'...
- 9
- 307
- 0
Báo cáo y học: "Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in fibroblast growth factor-2" potx
... 5'-TGCTAAAGGCTGCGAAT GG-3' (forward) and 5'-AAAAAGGAATGCAGCA AAGAAG A- 3' (reverse) DNA and glycosaminoglycan assays The wet mass of cell aggregates was recorded at 14 days and the aggregates were ... 5'TCTCGGCCATTTTTCCCATA-3' (reverse); COL1 0A1 , 5'TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAGTACAGTGCATAAATAAATAATATATCTCCA-3' (reverse); COL1 1A2 , 5'-CCTGAGCCACTGAGTATGTTCATT-3' (forward) and 5'-TTGCAGGATCAGGGAAAGTGA-3' ... 5'-TTGCAGGATCAGGGAAAGTGA-3' (reverse); L-SOX5, 5'-GAATGTGATGGGACTGCTTATGTAGA-3' (forward) and 5'-GCATTTATTTGTACAGGCCCTACAA-3' (reverse); SOX6, 5'-CACCAGATATCGACAGAGTGGTCTT3' (forward) and 5'-CAGGGTTAAAGGCAAAGGGATAA-3'...
- 11
- 459
- 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf
... of mesenchymal stem cells in humans Arthritis Rheum 2006, 54:843-853 Yoshimura H, Muneta T, Nimura A, Yokoyama A, Koga H, Sekiya I: Comparison of rat mesenchymal stem cells derived from bone marrow, ... Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR: 19 20 21 22 23 24 25 26 Multilineage potential of adult human mesenchymal stem cells ... non-cartilage Noncartilage only Matrix-staining (metachromasia) Normal (compared with host adjacent cartilage) Slightly reduces Markedly reduced No metachromatic stain Surface regularitya Moderate...
- 10
- 470
- 0
Báo cáo y học: "Endogenous and exogenous stem cells: a role in lung repair and use in airway tissue engineering and transplantation" pdf
... Komura M, Komura H, Kanamori Y, Tanaka Y, Suzuki K, Sugiyama M, Nakahara S, Kawashima H, Hatanaka A, Hoshi K, Ikada Y, Tabata Y, Iwanaka T: An animal model study for tissue-engineered trachea ... Nishimura Y, Hamazaki TS, Komazaki S, Kamimura S, Okochi H, Asashima M: Ciliated cells differentiated from mouse embryonic stem cells Stem Cells 2006, 24:1381-1388 24 MacPherson H, Keir PA, Edwards ... factor in maintaining pluripotency; MMP: matrix metalloproteinase; MSC: mesenchymal stem cell; Nanog: a key transcription factor in maintaining pluripotency; Oct4: Octamer-4, a homeodomain transcription...
- 9
- 487
- 0
Báo cáo y học: "Identification of a truncated form of methionine sulfoxide reductase a expressed in mouse embryonic stem cells" pps
... pairs to amplify the truncated form of MsrA and introduce a BamHI cutting site at the 3’ end (MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-BamHI-rev: 5’-tggggccaaggatccgctttgaaagaacc) The amplicons ... collection and assembly of data, data analysis and interpretation, manuscript writing and final approval of the manuscript XH Participated in the collection and assembly of data, data analysis and interpretation, ... [15] MsrA cDNA was amplified from the total RNA extracted from cultured embryonic stem cells using the primer pairs of: MsrA-for: 5’-cctggctgcggaggtggagaaac and MsrA-rev: 5’-atggccatcgggcaggaaactcc...
- 10
- 309
- 0
Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx
... [6] Also, it is believed that a scaffolding material might be needed to allow the MSCs to attach and engraft [7] Platelet-rich plasma (PRP) was used as a growth factor and as a differentiating agent ... physical examination, there was mild joint swelling, a decreased range of motion and tenderness with flexion Apley and McMurray tests were negative, and there was no ligament laxity A pre-treatment ... abdominal area with povodineiodine and placing sterile drapes, an incision of approximately 0.5 cm was made approximately cm below the umbilicus Then, using tumescent solution (500 cm normal saline,...
- 8
- 293
- 0
Báo cáo y học: " Curcumin mediated suppression of nuclear factor-κB promotes chondrogenic differentiation of mesenchymal stem cells in a high-density co-culture microenvironment" pdf
... promote cartilage degradation and stimulate further joint inflammation (4) and a self-perpetuating inflammatory and catabolic cascade develops As illustrated, cartilage contains chondrocytes and ... collection and interpretation, and manuscript preparation AM, UM and MS conceived of the study design and coordinated the studies, data interpretation and manuscript preparation All authors have read and ... curcumin as a potential new therapeutic for the prophylactic treatment of OA/RA and for OA/RA cases where cartilage damage is marginal Abbreviations AP30 3a: alkaline phosphatase linked sheep anti-mouse;...
- 15
- 328
- 0
Báo cáo y học: "Notochordal conditioned media from tissue increases proteoglycan accumulation and promotes a healthy nucleus pulposus phenotype in human mesenchymal stem cells" pot
... 24:3531-3541 14 Sakai D, Mochida J, Iwashina T, Watanabe T, Nakai T, Ando K, Hotta T: Differentiation of mesenchymal stem cells transplanted to a rabbit degenerative disc model: potential and limitations ... derived MSCs samples (age range 22 to 37 years, n = 3) were purchased from Texas A &M (Temple, TX, USA) with the appropriate Material Transfer Agreement and expanded in monolayer culture in alpha MEM ... by a wash with PBS Images were captured on an Olympus BX50 light microscope (Center Valley, PA USA) at 20 × magnification Glycosaminoglycan (GAG) and DNA content Mass spectrometry and data analysis...
- 13
- 349
- 0
Báo cáo y học: " Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions" pps
... Varambally S, Barrette TR, Sanda MG, Pienta KJ, Ghosh D, Chinnaiyan AM: α-Methylacyl coenzyme A racemase as a tissue biomarker for prostate cancer JAMA 2002, 287:1662-1670 Stuart RO, Wachsman W, ... cancer markers from the Affymetrix dataset by real time PCR (Figure 3a) For example, alpha-methylacyl-CoA racemase, a phenotypic marker identified in the first microarray experiments on prostate cancer ... Shinohara T, Avarbock MR, Brinster RL: β1- and α6-integrin are surface markers on mouse spermatogonial stem cells Proc Natl Acad Sci USA 1999, 96:5504-5509 Chan JM, Stampfer MJ, Giovannucci E, Gann...
- 13
- 682
- 0
Báo cáo sinh học: " Improved gene delivery to human saphenous vein cells and tissue using a peptide-modified adenoviral vector Lorraine M Work1, Paul N Reynolds2 and Andrew H " pptx
... explants from the same material and maintained in Dulbecco's modified Eagle's medium (DMEM) with 4500 mg/l glucose supplemented with 20% (v/v) FCS and 100 IU/ml penicillin, 100 µg/ml streptomycin ... (VICTOR2) Multilabel Counter with recombinant luciferase (Promega) as a standard and normalised for total protein Ad-RGDLuc mediated a time-dependent increase in the level of transgene expression that ... RJ, Alpert JS, Eagle KA, Gardner TJ, Garson A, Gregoratos G, Russell RO, SC Smith, McEntee CW, Elma MA, Pigmann GC, Starke RD, Taubert KA: ACC/AHA guidelines for coronary artery bypass graft...
- 4
- 315
- 0
Báo cáo y học: "A recessive genetic screen for host factors required for retroviral infection in a library of insertionally mutated Blm-deficient embryonic stem cells" doc
... Nucleotide/primer Sequence Splinkerette nucleotides HMSpAa 5'-CGA AGA GTA ACC GTT GCT AGG AGA GAC CGT GGC TGA ATG AGA CTG GTG TCG ACA CTA GTG G-3' HMSpBb-Sau3AI 5'-gat cCC ACT AGT GTC GAC ACC AGT CTC TAA ... mCAT1-exon4-F 5'-GTA CTT CAA GCG TGG CAA GAG-3' mCAT1-exon7-R 5'-CTG GTG GAA AGT GCG CAG AGA-3' mCAT1-exon8-F 5'-TCT CCT AGG CTC CAT GTT TCC C-3' mCAT1-exon12-R 5'-CTA TCA GCA TCC ACA CTG CAA ... GAA ACA GCT ATG AC-3' RT-PCR primers Oligo-dT primer 5'-GGC CAC GCG TCG ACT AGT AC (T)17-3' mCAT1-exon1-F 5'-GCG TGC GCC ATC CCC TCA GCT AGC A- 3' mCAT1-exon3-R 5'-CGA TGA TGT AGG AGA GAA TCA...
- 11
- 339
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25