... Team LiB ] Recipe 5.11 Exporting the Results of a Query as a String Problem You need to export the results of a query to a string in a manner similar to the GetString( ) method of the ADO ... The character or characters that separate rows. The default value is the CARRIAGE RETURN character. nullExpr A string that is substituted for null column values in the table. The default value ... Recordset. The method iterates over the collection of rows and columns in the table appending the field values to a string. Null values are replaced as specified and column and row delimiters are applied....
Ngày tải lên: 24/12/2013, 05:15
... the rows and columns in the table. The number of columns in the array is set to hold either all of the columns in the table or the subset of columns defined by the optional string array of column ... functionality of the ADO Recordset's GetRows( ) method. The sample code contains an event handler and a method: Go Button.Click Sets up the sample by creating a DataTable containing the Orders table ... to an Array Problem You need to export the results of a query to an array in a manner similar to the GetRows( ) method of the ADO Recordset. Solution Write a routine to mimic the functionality...
Ngày tải lên: 26/01/2014, 10:20
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
Ngày tải lên: 28/03/2014, 20:20
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... which the air dry bulb temperature decreases as its humidity increases. Thus, the amount of heat transferred from the air to the water is the same as the one employed in the evaporation of the water ... heat-transfer areas in compact distributions [7]. As the main resistance to heat-transfer can be found in the air on the dry face of the system, the advantage of the higher thermal conductance ... on the amount of evaporated water from the humid surface into the air. Thus, the mechanisms of mass- transfer are consequence of the mass-diffusion through the ceramic material (water capillary...
Ngày tải lên: 05/09/2013, 16:10
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC
Ngày tải lên: 07/09/2013, 13:06
Itzhak Perlman: a citizen of the word, with his violin as a passport
... music has made him a citizen of the world. He has played in almost every major city. Download this story as a PDF He has won many Grammy awards for his recordings. He has also won Emmy awards ... his playing so special. They say he is able to communicate the joy he feels in playing, and the emotions that great music can deliver. Anyone who has attended a performance by Itzhak Perlman will ... Itzhak Perlman: a citizen of the word, with his violin as a passport STEVE EMBER: Many consider him the greatest concert violinist in the world. The music of Itzhak Perlman is our program today...
Ngày tải lên: 11/03/2014, 15:38
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... phos- phate as a substrate for localization of the labeled MYP. Statistical analysis Data were expressed as the mean ± SEM. Statistical analy- sis was performed using instat software (GraphPad Soft- ware). ... blot analysis appeared rather broad, probably because large amounts of unlabeled CFMYP and EGMYP naturally present in the gonads formed broad bands and affected the shape of the bands of the labeled ... Soft- ware). The normality of the distribution of data was evaluated using the Kolmogorov–Smirnov test. The equal- ity of the standard deviations of the groups was assessed with Bartlett’s test. The...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic errors [26,27]. Adequate support for ... maintenance. Mitochondria are the main source of ROS formation, as well as the main target for free radical attack. The accumulation of defective mitochondria within aging cells suggests that some are not properly autophagocytosed. Aged ... Georgetown, Texas. 25. Brunk, U.T. & Terman, A. (1999) The mitochondrial-lysosomal axis theory of cellular aging. Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas,...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 ... Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas...
Ngày tải lên: 23/03/2014, 05:22
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit. Secondary outcome was change in OSWESTRY disability index from preoperative evaluation ... group are warranted to further evaluate the relative efficacy of this surgical treatment in patients with facet joint disease. Conflict of Interest The authors have declared that no conflict of ... disease after a mean follow-up of 13.7 months. Iwatsuki et al. 5 reported significant pain relief in 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule....
Ngày tải lên: 26/10/2012, 09:32
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... (Anhui, China) program. Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the systemic circulation and is available at the site of action. ... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice. Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to ... Abstract To develop pullulan acetate nanoparticles (PANs) as a drug nanocarrier, pullulan acetate (PA) was synthesized and characterized. Its acetylation degree determined by the proton nuclear...
Ngày tải lên: 23/04/2013, 21:38
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
Ngày tải lên: 05/09/2013, 09:38
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
Ngày tải lên: 05/09/2013, 15:28
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY
Ngày tải lên: 07/09/2013, 13:45
Bạn có muốn tìm thêm với từ khóa: