epidemiology of colorectal cancer and colorectal cancer screening a background paper
Bóa cáo y học: "Estimating the cost of cervical cancer screening in five developing countries" docx
... Chaithongwongwatthana (Chulalongkorn University, Bangkok, Thailand); India (International Agency for Research on Cancer- World Health Organization [IARC-WHO]): R Sankaranarayanan and R Muwonge (IARC-WHO, ... reliance on national averages for road network density and rural population density Additionally, changes in elevation and natural obstacles such as the Peruvian Andes affect the estimates of transport ... by the lab: LabArea = AnnualSamples * Capacity % RuralDensityScreenEligibles Each laboratory is assumed to serve all eligible individuals within a laboratory area All laboratory areas taken together...
- 17
- 335
- 0
Prostate Cancer Screening : A Decision Guide for African Americans doc
... When compared to all causes of death, prostate cancer is the fourth leading cause of death among African American men over age 45 Top Ten Causes of Death among African American Men over Age 45 ... your particular case How serious is prostate cancer in African American men? Among the 10 leading causes of cancer death in African American men, prostate cancer is second, behind lung cancer ... sometimes spread to other parts of the body, multiply, and cause death What causes prostate cancer? As with many types of cancers, medical experts not know what causes prostate cancer They are studying...
- 20
- 354
- 0
Prostate Cancer Screening: A Decision Guide docx
... multiply, and cause death What causes prostate cancer? As with many types of cancers, medical experts not know what causes prostate cancer They are studying several possible causes Can prostate cancer ... have a life expectancy of at least 10 years should be offered the PSA test and DRE annually beginning at age 50 They also recommend offering screening tests earlier to African-American men, and ... can’t always be sure what type of cancer is present in your particular case Among the leading causes of cancer death in men, prostate cancer is second, behind lung cancer When compared with all...
- 20
- 313
- 1
báo cáo khoa học: " The epidemiology of college alcohol and gambling policies" pot
... etc.) for comparison against handbooks and Web-based materials We conducted a visual search of all hard-copy handbooks and supplemental policy materials and extracted all relevant information from ... circumstance exists in part because of their age and the prevalence of drug and alcohol abuse among their peers Students need to be aware of the potential health and treatment options that are available ... set a liberal alpha level (α = 1) for this analysis A one-way analysis of variance (ANOVA) revealed that four of the 22 policy variables had significant relationships with binge drinking rates at...
- 20
- 420
- 0
Epidemiology of palsma lipids and the metabolic syndrome in multi ethnic population
... with an intra-assay coefficient of variation (CV) of 1.2% and an interassay CV of 1.5% Total cholesterol (intra-assay CV 3.0% and interassay CV 4.1%) and triglyceride (TG) (intra-assay CV 1.4% and ... learn a great deal for it Dr Derrick Heng and Dr Chew Suok Kai at the Ministry of Health They allowed me access to the data and materials from the various National Health Surveys and facilitated ... associated with obesity and hypothesized that intracellular fatty acid accumulation would lead to an increase in the intramitochondrial acetyl coenzyme A (CoA)/CoA and NADH/NAD+ ratios, leading...
- 148
- 248
- 0
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell
... is change for planar shape, where under the land areas a noticeable decrease takes place It can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer ... might lead to the onset of pore plugging, which has a detrimental effect of the fuel cell performance This model is used to analyse and evaluate the performance of a planar and a tubular-shaped ... Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cell consist of cathode and anode gas flow fields, and the MEA are shown in Figure 2.2 Model equations...
- 26
- 609
- 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; ... rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han J.C Turbulent Heat transfer and friction in a square channel ... Tariq, A. , Keshav Kant and Panigrahi, P K., “Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference on Heat and Mass transfer...
- 12
- 831
- 0
Knut Einar Rosendahl (ed.) Social Costs of Air Pollution and Fossil Fuel Use – A Macroeconomic Approach pdf
... is maintained and 50 per cent replaced The prices of maintenance and replacement of materials depend inter alia on the extent of damage, building size and shape, design, material quality and ... cultivated meadow (i.e., surface-cultivated and fertilised pasture), and potatoes Data on agricultural areas are taken from information provided by Social Costs of Air Pollution farm operators as a ... considerably the last decade New research has managed to estimate quantitative relationships between particularly air pollution and various human and nonhuman damages These associations are commonly...
- 147
- 424
- 0
Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx
... 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ 5¢-TAGGATCCCTTTTGCCTCTTGTAAAT-3¢ 5¢-ATGGATCCGGAATGAGTAGTACCGATCTG-3¢ 5¢-TAGGATCCAATTTTGATGGAGTCCAC-3 5¢-ATGGATCCGGAATGGCCTCAGCAGCAGTT-3¢ FPPS N-terminal FPPS C-terminal eAS N-terminal eAS C-terminal ... sites are underlined Primer Sequence Template P1 P2 P3 P4 P5 P6 P7 P8 5¢-TAGATCCATGGGTAGTACCGATCTG-3¢ 5¢-CTACTCGAGCTACTTTTGCCTCTTGTA-3 5¢-TAGAGCCATGGCCTCAGCAGCAGTT¢-3¢ 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ ... hexane phase (350 lL) was removed and extracted with water (300 lL) An aliquot (200 lL) of the hexane phase was taken into a scintillation vial and measured in a scintillation counter eAS An aliquot...
- 8
- 410
- 0
modeling of chemical kinetics and reactor design by a. kayode coker
... study of the fundamentals and mechanisms of chemical reactions The availability of personal computers has enhanced the simulation of complex chemical reactions and reactor stability analysis ... user of ammonia, and large quantities must be stored to meet the demand and maintain constant production levels Ammonia may be stored in very large insulated tanks at pressure near ambient; in large ... material source for ammonia plants is natural gas for producing hydrogen by steam reforming An alternative raw material is naphtha, which also requires partial oxidation Hydrogen streams from catalytic...
- 1,126
- 7,536
- 0
applications of chimeric genes and hybrid proteins, part a
... immA imm21 immA, Kan R immA imm21 irnmA, Kan R IacZYA ' lacZYA ' lacZYA ' lac "ZYA' lac "ZYA' lac "ZYA' Transcriptional Transcriptional Transcriptional Translational Translational Translational ... ("CEKG 4") GTGCAGTAATATCGCCCTGAGCA GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT ATCCCCCTGGATGGAAAACGG GGCCACGCGTCGACTAGTAC "Three different ... necessary for translational initiation and contain functional copies of both lacZ and lacy genes, but are truncated in lacA (and are lacA ) Fusions designated lac'ZYA' are deleted for the translation...
- 614
- 282
- 0
formation of zno thinfilms consisting of nano-prisms and nano-rods with a high
... positively charged Zn (0001) and negatively charged O (000l) surfaces, resulting in a normal dipole moment and spontaneous polarization along the c-axis as well as a variance in surface energy ... Na3-citrate and Al(NO3)$ 6H2O as surfactant chemicals in the hydrothermal synthesis at 60 C Experimental details Zinc nitrate hexahydrate (Zn(NO3)$6H2O) was used to grow ZnO crystals, and aluminum ... indication of an interfacial reaction or any formation of amorphous compounds The SAED pattern showed that the film was c-axis oriented in the substrate normal direction with a slight out -of- plane...
- 5
- 274
- 0
báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc
... of occupational stress in urban EMT-paramedics [see comment] Ann Emerg Med 1989, 18:1151-1156 Mahony KL: Management and the creation of occupational stressors in an Australian and a UK ambulance ... Journal of Occupational Medicine and Toxicology 2011, 6:10 http://www.occup-med.com/content/6/1/10 Page of Table Means, standard deviations and comparison between the sample available at T1 only and ... Table Bivariate Pearson’s correlations between independent variables measured at T1 and job satisfaction, emotional exhaustion, psychological distress and musculoskeletal pain measured at T1 and...
- 9
- 531
- 0
Báo cáo hóa học: " Fabrication of functional micro- and nanoneedle electrodes using a carbon nanotube template and electrodeposition" ppt
... nanoneedle (a) Carbon nanotube nanoneedle before Au nanoparticle coating and (b) after Au nanoparticle coating (scale bar: μm) (c) Magnified view of Au nanoparticle-coated nanoneedle (scale bar: ... interest factors to most biologists because changes in intracellular pH affect the ionization state of all weak acids and weak bases and thus potentially affect a wide array of biological processes ... real applications of micro- and nanoneedles, the needle must be attached to a supporting structure such as an AFM tip or a metal tip CNT can be easily attached to the end of a metal tip or an AFM...
- 6
- 360
- 0
Báo cáo lâm nghiệp: "Analysis of snow accumulation and snow melting in a young mountain spruce and beech stand in the Orlické hory Mts., Czech Republic" pptx
... part to the soil surface sooner or later but its spatial variability was great and these values have to be regarded as approximations For example, from January to 24 January, precipitation amounting ... situation in the spruce stand has to be taken into account at interpreting and analyzing results of depth/weight measurements of the snowpack For the actual measurement of snow a verified standard ... Type of precipitation Spruce stand Precipitation (mm) Date of measurements Table Basic parameters of snow cover at the permanent field research station Deštné in the spruce and beech stands and...
- 15
- 348
- 0
Báo cáo khoa học: "Validity of leaf areas and angles estimated in a beech forest from analysis of gap frequencies, using hemispherical photographs and a plant canopy analyzer" pot
... length and shoot leaf area A planimeter (Delta-T area meter, Delta-T Devices, Cambridge, UK) was used to measure leaf area 2) At branch level, a sample of 221 branches was collected Allometric relationships ... branch diameter and branch leaf area were established for four classes of branch age (1-2, 3-4, 5-6 years and years and older), using the measured parameters of the branches (diameter, length of ... for each ring, a gap fraction computed as the ratio of light levels measured above and below the canopy The spatial variability of the gap fraction is accounted in part by averaging K values...
- 10
- 384
- 0
Báo cáo khoa học: "Influence of decaying wood on chemical properties of forest floors and surface mineral soils: a pilot study" pptx
... in detail in Lowe (1974) and Lowe and Klinka (1981) Mineral soil samples were also analyzed for oxalate Fe and Al and dithionite Fe, Al and Si Oxalate Fe and Al were extracted using acid ammonium ... Autoanalyzer Extractable -S SO was determined by ammonium acetate extraction (Tabatabai, 1982) and turbidimetry Extractable Ca, Mg and K were determined by extraction with Morgan’s solution of ... and classification The Iowa State Univ Press, Ames, IO, USA Canada Soil Survey Committee (1978) The Canadian system of soil classification Can Dept Agric Publ 1646, Supply and Services Canada,...
- 11
- 389
- 0
Báo cáo lâm nghiệp: "Changing electrophoretic patterns of glutamate dehydrogenases and aspartate aminotransferases in a few tree species under the influence of ectomycorrhization" potx
... Glutama dehydrogenases in ectomycorrhizas of spruce (Picea excelsa L.) and beech (Fagus sylvatica L.) New Phytol 111, 683-692 Khalid A. , Boukroute A. , Botton B & Martin F (1988) The aspartate aminotransferase ... electrophoresis confirmed the presence of NAD-GDH in the host cells (one band) and the presence of a high level of NADP-GDH activity in the fungus (one major band and one minor band) Both GDHs were detected ... cortical region including host cells and fungal hyphae revealed identical isoforms, while no activity was found in the peri- pheral mycelial layer (Table II) Conclusion In all the associations...
- 3
- 240
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008