electronics and who is prepared to mess about with circuit diagrams a soldering iron and perhaps a voltmeter logic probe or oscilloscope still further possibilities open up one of t
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... fitness of the recTULV might be that it was generated in the presence of the wt variant, with which it has to compete, and thus not given enough time to to establish a well balanced, mature quasi-species ... experiments and helped to draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... fitness of the recTULV might be that it was generated in the presence of the wt variant, with which it has to compete, and thus not given enough time to to establish a well balanced, mature quasi-species ... experiments and helped to draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors...
- 5
- 430
- 0
Báo cáo y học: " Prolonged venous bleeding due to traditional treatment with leech bite: a case report" potx
... performed the surgery BK, NEB, OB, HA, KM analyzed and interpreted the clinical data, and BK was a major contributor to writing the manuscript All authors read and approved the final version of the manuscript ... patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Authors’ contributions BK performed ... inhibitory effect, causes a decrease in platelet aggregation It is thought that the prolongation of bleeding after leech bite is mainly due to hirudin Histamine-like substance is another protein that...
- 3
- 449
- 0
Tài liệu Electronics and Communication Engineering: Introduction to VHDL ppt
... output is known as NOT A This is also shown as A' , or A with a bar over the top, as shown at the output, i.e., Y= A' NAND gate This is a NOT -AND gate which is equal to an AND gate followed by a NOT ... styles are adhered to and delay calculation tools are available The standardization effort named VITAL (VHDL Initiative toward ASIC Libraries) is active in this area, and is now bearing fruit ... COMMUNICATION ENGINEERING The NAND and NOR gates are called universal gates since with either one the AND and OR functions and NOT can be generated Table is a summary truth table of the input/output...
- 325
- 436
- 0
Tài liệu What You Need To Know About - Melanoma and Other Skin Cancers doc
... “metastatic tumor” or a “metastasis.” The metastatic tumor contains cells that are like those in the original (primary) tumor The plural form of metastasis is metastases (meh-TAS-tuhSEEZ) Metastatic ... nodes and other organs 20 Treatment Treatment for skin cancer depends on the type and stage of the disease, the size and place of the tumor, and your general health and medical history In most cases, ... sunlight and bright indoor light for at least weeks after treatment The NCI fact sheet Photodynamic Therapy for Cancer has more information 29 You may want to ask your doctor these questions about...
- 59
- 497
- 0
Tài liệu What Lung Cancer Patients Need to Know About Bone Health: A Publication of The Bone and Cancer Foundation pdf
... Nonsteroidal Anti-inflammatory Drugs: Drugs such as acetaminophen, aspirin, and ibuprofen used to treat pain and inflammation Metastasis (plural: metastases, verb: metastasize): The spread of cancer ... designated 501c3 organization A copy of the Foundation’s annual report is available by writing to the Foundation office or the Office of the Attorney General, State of New York, Charities Bureau, ... cells throughout the body The cancer cells that have spread to other parts of the body are the same as those in the original tumor Radiation therapy: Treatment with radiation to kill cancer cells...
- 8
- 444
- 0
Tài liệu Agile Project Management Methods for ERP: How to Apply Agile Processes to Complex COTS Projects and Live to Tell About It docx
... there is information about uncertainty and values In the low volume world of IT projects, obtaining valid data about future values, treating this data consistently, and dealing with the unqualified ... in an open market An option that gives the right to acquire an asset is a call option; an option that gives the right to dispose of an asset is a put option The value of an option is linked to ... unified and coherent structure consisting of constituent parts and connections that establish how these parts fit and work together [69] Many of the attributes of building architecture are applicable...
- 21
- 595
- 1
Tài liệu Hope and Healing for Kids Who Cut: Learning to Understand and Help Those Who Self-Injure ppt
... choices at least somewhat understandable But what about those kids who come from homes that appear to be healthy and functional, yet still turn to self-harm as a way of coping? Meet Andy, an athletic, ... for attention) then at least I know where to start.” This attempt to explain the mysterious with a simple theory that makes it more familiar and manageable may give some 35 HOPE AND HEALING FOR ... a particularly pleasant book to read⎯frankly, it’s not a pleasant topic to write about either But I believe it’s absolutely critical that we learn all we can about this issue of self-injury that...
- 164
- 475
- 1
From Investment funds and Asset Management Companies to questions about Africa’s farmers pptx
... 1) Thanks to total control and to the circulation of capital and information flows, this approach also aims at limiting transaction costs and the risks inherent to the agricultural activity Figure ... only the problem of concentration and dualisation of the sector, it also draws attention to the need to analyse this phenomenon within the framework of the strategies of these actors Indeed, the ... farming sector is presently characterized by important restructurings, related to the recent agricultural and financial crises and characterized by the “financiarisation” and "corporisation" of...
- 14
- 716
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result of the presence of the N-terminal domain of ... peptides in our list using the available softwares (gpmaw [30], xquest [31] and msx-3d [12]) with a mass tolerance of p.p.m We therefore used MALDITOF-TOF and ⁄ or nanoLC-Orbitrap tandem MS to further ... BS3 treatment at the origin of electrophoretic modifications are labeled with stars to Ure2p and Ssa1p can be estimate as ± and 10 ± for BS2G and BS3, respectively Identification of modified and...
- 12
- 510
- 0
Emerging Threats and Security Planning - How Should We Decide What Hypothetical Threats to Worry About pdf
... ways terrorists could attack targets in addition to using UAVs so that we could systematically compare the advantages and disadvantages to terrorists of this attack mode For example, to solve the ... government systems that captured their identity when they entered the target to stage the attack), UAVs could allow them to attack from afar and make it easier to stage a long-term terrorist campaign ... process to systematically measure them against the six factors in Table To so, we develTable Characteristics of Attacks Related to Operational Risk Characteristic Operational Risk Operational Complexity...
- 31
- 415
- 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
... vector, pET ⁄ PCaP1, was then directly amplified by PCR with a pair of primers (forward, 5¢-CACCACCACCACCAGATGGGTTACTGGAATTCCA AG-3¢; reverse, 5¢-GTGGTGTTTCATATGTATATCTCCT TCTTAAAGTTAAAC-3¢; italic ... PCaP1, and the interaction with PtdInsPs may contribute to the stability of the attachment of PCaP1 to the membrane It has been shown that the attachment to the membrane is stable under physiological ... conclude that PCaP1 is myristoylated at Gly2 and that cotranslational myristoylation anchors the protein to the membrane N-myristoylation is catalysed by two enzymes, namely methionine aminopeptidase...
- 16
- 424
- 0
How Is Deployment to Iraq and Afghanistan Affecting U.S. Service Members and Their Families potx
... which offers an important after-tax advantage The RAND estimates, in contrast, factor in the value of this tax preference These estimates indicate that the value of the tax advantage accounts for ... Considerably from the Estimates Based on Survey Data? The RAND estimates have several advantages that likely make them more accurate than the survey-based estimates: The RAND estimates factor in the ... individual’s response to a stressor and factors that moderate the effects of stress on performance.2 Training is the most important moderator in the military context It is proven not only to reduce the...
- 62
- 341
- 0
Báo cáo khoa học: Caspase-2 is resistant to inhibition by inhibitor of apoptosis proteins (IAPs) and can activate caspase-7 pot
... 5¢-GGCAGATCTCATATGAATAAAGCT GGTCCTGTCTGC-3¢; 26, 5¢-GGAATTCCATATGTGTG TAATTTTTCCGGTAG-3¢; 27, 5¢-CCCTCGAGTTTAAT TGTGTTTAATATTAC-3¢; 28, 5¢-GCGGATCCATGACT TTTAACAGTTTTGAAGG-3¢; 29, 5¢-GAGAATTCTTAA GACATAAAAATTTTTTGCTTG-3¢; ... 5¢-GGGGATCCTGCGTGGTTCTTTCC ATCTTGTTGGTCAACCCCACGATCAGTCTCATCTCC ACGGGCGGCCTG-3¢; 8, 5¢-GCTCTAGATTAATCTTT ATTGTCTAGGGAGTGTTCC-3¢; 9, 5¢-GGCGTCGACA GATACTGTGGAACACTCCCTAGACAATAAAGCTGG TCCTGTCTGC-3¢; 10, ... TTATTTTTATTTTATTGAGAGGGTGG-3¢; 15, 5¢-GCG GATCCCTCGAGAAACCCAAACTCTTCTTCATTCAG GCTGCCCGAGGGACCGAGCTTG-3¢; 16, 5¢-CCACTTT AACTAATACTTTCAACATTTTCGG-3¢; 17–5¢-GGCCTC GAGAAGGGTTTTGCATC-3¢; 18, 5¢-GGATTCATGACT...
- 14
- 348
- 0
“Mostly Free” The Startling Decline of America’s Economic Freedom and What to Do About It pdf
... practices that significantly distort trade The most significant are: • Tariff quotas About percent of U.S tariff lines are subject to tariff quotas (a specified amount of a good—the quota is ... Burma Indonesia Mongolia Uruguay Libya Haiti Iran Sierra Leone Trinidad and Tobago Uganda Pakistan Burkina Faso Tanzania Estonia Czech Republic Laos Samoa Peru Azerbaijan Guatemala Ecuador Malawi ... Egypt Mauritania Vietnam Uruguay Uzbekistan Trinidad and Tobago Saint Lucia Tonga Namibia Congo, Republic of Switzerland Saudi Arabia Bolivia Samoa Botswana Russia Macedonia Cape Verde Georgia Australia...
- 20
- 465
- 0
A comprehensive guide to digital electronics and computer system architecture mcgraw hill
... focus on the critical analog support circuitry that is important to any viable computing system These topics include basic DC and AC circuit analysis, diodes, transistors, op-amps, and data conversion ... early interest in electronics and computers that was fully supported and encouraged by my family Whether it was the attic turned into a laboratory, a trip to the electronic supply store, or accompaniment ... identity states that the product of any variable and its logical negation must always be false It has already been shown that both operands of an AND function must be true for the result to be true...
- 481
- 1,429
- 3
Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot
... Heider, Andrea Kosel, and Miriam Ramming for processing the tissue specimens and operating the immunohistochemistry autostainer apparatus Author details Department of Oral and Maxillofacial Surgery ... mucosa soft tissue repair in BRONJ Our findings indicated that BRONJ was associated with an impairment in TGFb1 signaling that was different than that associated with osteoradionecrosis of the jaw ... performed the histomorphologic analysis of the changes in BRONJ-affected oral mucosa and mucoperiosteal soft tissue PS and KS performed the immunohistochemical analysis FN interpreted the data and...
- 11
- 416
- 0
Báo cáo hóa học: " Abnormal coactivation of knee and ankle extensors is related to changes in heteronymous spinal pathways after stroke" pot
... Extremity Motor Coordination Test (LEMOCOT), validated for stroke individuals [26] In this test, participants are seated and instructed to alternately touch with their foot, as fast and as accurately ... using software constructed on a LabVIEW 5.0 platform (National Instruments) and stored on computer for later analysis Experimental protocol for coactivation assessment Prior to each task and to any ... abnormal coactivation of knee and ankle extensors on the paretic side of stroke patients The motor impairment of the paretic leg is strongly associated with the abnormal coactivation of biarticular...
- 14
- 546
- 0
báo cáo hóa học: " Interleukin-1alpha expression precedes IL-1beta after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues" pdf
... manuscript AD carried out the surgeries, contributed to the design and analysis of the study and wrote the manuscript All authors read and approved the final manuscript Acknowledgements This work was ... inflammation early after cerebral ischemia This adds to the growing body of evidence that IL-1α is a key mediator of the sterile inflammatory response Findings Inflammation is recognised as a major ... and late (24h) after stroke induced by MCAo Such a study was required since strategies aimed at inhibiting inflammation in the brain will be dictated by the nature of the inflammatory mediators...
- 16
- 425
- 0
Báo cáo hóa học: " Vaccinia virus lacking the deoxyuridine triphosphatase gene (F2L) replicates well in vitro and in vivo, but is hypersensitive to the antiviral drug " pot
... of the studies and the critical review of the manuscript DCQ contributed to the design of the experiments and analysis of the data KAK contributed to the acquisition and interpretation of data ... thymidine analogs was selected and a standard plaque reduction assay was used to evaluate the susceptibility of the dUTPase mutant and the parent virus The mutant remained fully sensitive to all of the ... or the spontaneous deamination of cytosine and can result in A: T transition mutations in one of the nascent strands [1] Minimizing the incorporation of these bases and excising those that arise...
- 6
- 330
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu