... that they not apprehend the truth, but that “the man without the Spirit does not accept the things that come from the Spirit of God” (1 Cor 2:14) It is not that they not perceive it, but that they ... revelation Within both groups there are conservatives and liberals, rightists and leftists, strict constructionists and broad constructionists The stark truth is that it matters little whether it ... grade, the student stormed into his professor’s office, protesting, “That’s not fair That’s not just!” The student’s reaction to the injustice done to him revealed, contrary to what he wrote, that...
... about the previous patient Rootcause analysis is designed to protect the next patient What safeguards can be put into place to ensure that the error doesnt happen again? The idea is to create ... rather than who made it; the goal is not to point fingers but to learn from the mistake so that future mishaps can be prevented Let’s look at a hypothetical significant incident (Table 1): At ... answered to the wrong name and complicated by repeated missed clues The Significant Event was the mix-up of the patients The root cause was an inadequate patient identification system Outcomes...
... institutions at the main refinancing rate and against adequate collateral Contrary to normal practice, financial institutions were allotted the full amount of liquidity that they sought at the ... be terminated by not renewing them upon maturity More concretely, the Eurosystem decided in December 2009 that the LTRO in that month would be the last one with a twelve-month maturity, that only ... market interest rates and that credit markets function smoothly The stable and predictable relationship between money market rates and the ECB’s main refinancing rate that prevailed until the middle...
... producing National Statistics The National Statistician has overall responsibility for the professional statistical quality of all outputs comprising National Statistics, and ensuring that they are produced ... proposed that all relevant data systems should be examined at least once during the “lifetime” of a PSA, and that where data is already subject to validation because it forms part of National Statistics ... Government believes that the form of accountability that applies to a body needs to take account of the relationship of that body to the Government, to Parliament and to other stakeholders Although...
... Differences in synovial tissue infiltrates between anti-cyclic citrullinated peptide-positive rheumatoid arthritis and anti-cyclic citrullinated peptide-negative rheumatoid arthritis Arthritis Rheum 2008, ... collection, evaluation, or interpretation of the data or on the preparation of this manuscript Authors' contributions BM supervised data collection, performed statistical analyses, and wrote the ... application as an alternative to or might add to quantitative RF analyses [12] These data on a level of statistical significance are essentially in agreement with reports about a trend toward shorter...
... in detoxification centers, rather, they have the right to select treatment or/and other services from authorized institutions that provide these services In addition, the law also orders that drug ... of detoxification treatment for drug users The implementation of this law requires not only strong central government support, multi-sectoral participation and collaboration, but also a strong ... coordinates and guides narcotics control activities in their jurisdictional areas The establishment of the commission and the committees demonstrates that the Chinese government has intensified its...
... SPECIAL THEMATIC CRISIS RESPONSE INITIATIVES The Bank’s crisis-response strategy included thematic initiatives to reinforce institutional priorities of protecting the vulnerable, preserving infrastructure, ... Under the plan, commitments to the Region are expected to be increased by at least $15 billion through 2012 Of this, IFC is expected to contribute at least $1 billion to facilitate trade, mainly through ... mainly through the GTFP and GTLP; strengthen the TABLE 3.5 IFC’s Crisis Initiatives: Funding and Deployment Funding Initiative Target Deployment Target Actual commitments Actual mobilization (by end...
... However, it is not a tool that can be wielded without consideration for the externalities attendant upon it: instead, attention should be paid to the EAEM’s impact upon geographic location of economic ... Clearly, therefore, the nature and indeed existence of the EAEM is not uncontested There has been a tendency to see the nature of the developmental state as being, in simple terms, statist in nature: ... income status to middle income status (that is, the EAEM), yet that method is insufficient for it to be transformed from middle income to high income status (Gill and Kharas, 2007: 178) A qualitative...
... allow the rational design of alternative treatment strategies Second, to prospectively identify patients who should not receive either treatment, this way avoiding their exposure to ineffective ... mutations inhibit the transcriptional activation of TAp73 induced after oxaliplatin treatment We came to the conclusion that if TAp73 is regulated differently depending on the B-Raf status, this could ... downregulation, while when B-Raf is wild type, the treatment induces TAp73 upregulation This induction is maintained when the treatment is combined with cetuximab We report, for the first time, that...
... of NOTCH mutations in the COSMIC database [19] for T- ALL tumors show a mutation frequency of 40% suggesting that T- ALL may also be a potentially attractive subtype for patient stratification ... prevalent for the less sensitive phenotypes mutations in NOTCH1 To investigate this further, we collected additional mutation data from public databases for T- ALL cell lines (Additional File 1, Table ... Modality in Patient Population To estimate the expected frequency of high chromosome modality in a prospective patient population, we reviewed the Mitelman Database of Chromosome Aberrations...
... of NOTCH mutations in the COSMIC database [19] for T- ALL tumors show a mutation frequency of 40% suggesting that T- ALL may also be a potentially attractive subtype for patient stratification ... prevalent for the less sensitive phenotypes mutations in NOTCH1 To investigate this further, we collected additional mutation data from public databases for T- ALL cell lines (Additional File 1, Table ... Modality in Patient Population To estimate the expected frequency of high chromosome modality in a prospective patient population, we reviewed the Mitelman Database of Chromosome Aberrations...
... consent and patients stopped for protocol violation Of the remaining 474 patients, 102 (22%) patients, who were not optimally responding to treatment according to the treating rheumatologist's ... facilitates the use of more complex statistical methods that can handle repeated measures over different time points [22-24] Other studies demonstrated that a low DAS is an important prognostic ... methotrexate in the treatment of rheumatoid arthritis Anti-Tumor Necrosis Factor Trial in Rheumatoid Arthritis with Concomitant Therapy Study Group N Engl J Med 2000, 343:1594-1602 Maini R, St...
... important difference between that study and ours is that our study was multicentre and that reported by Soubrier and coworkers was a monocentre study In a monocentre study, it is intuitive that the ... best reflects the physician’s clinical judgment of response to infliximab therapy in rheumatoid arthritis patients: validation of the DAS28 score in patients under infliximab treatment Arthritis ... Competing interests The authors declare that they have no competing interests Page of (page number not for citation purposes) Aletaha D: Pooled indices to measure rheumatoid arthritis activity:...
... LPS treatment, a TLR4 ligand, is needed to stimulate the chronic autoimmune state in the mice The endotoxin LPS is known to up-regulate multiple TLRs in the mouse brain and in TMEV-infected microglia[3,4] ... autoimmunity is still debated Some have suggested that Th1-mediated autoimmunity could be mediated through MyD88 activation, a common signal transduction protein used by most TLRs[18] Furthermore, TLR9 and ... looking at the reactivity of the signaling through TLRs, which could open the door to detecting such disorders promptly and optimizing their treatment at an earlier phase in their development http://www.virologyj.com/content/5/1/154...
... Journal 2009, 6:7 at the N-terminus end regarding the position of the initiation codon of protein translation of the viral genome [1] It has been demonstrated that the C-terminal part of the preS1 region ... protein We demonstrated that those newborns that developed antibody reactivity against two or three B-cell epitopes had a significantly stronger anti-HBs response than those individuals that showed ... shown in the mouse system List of abbreviations HBV: hepatitis B virus; HBsAg: hepatitis B surface antigen; Anti-HBc: antibody to hepatitis B core antigen; Anti-HBs: antibody to hepatitis B surface...
... with the forward primer (5’-CGAATTCTGATGGTGCCCATTATTG-3’) and reverse primer (5’TGGATCCCGCAGGTGGTCAATG TCCCA-3’) to generate EcoRI and BamHI restriction sites and subcloning into pEGFP-N1 HA-tagged ... interferes with, rather than facilitates Vpu activity, this putative factor still needs to be identified This factor should bind to the phosphorylated di-serine motif of Vpu and is predicted to ... cellular b-TrCP (see summary of results in Table 1) We found that b-TrCP2, not the structurally related b-TrCP1, is the critical Vpu adapter for the E3 ubiquitin ligase complex that targets both CD4...
... considered a potential marker trait for this purpose T- cells play a dual role in the pathogenesis of MD, in that they are both the target cells for neoplastic transformation, and act with natural killer ... virulent viruses, and (2) what is the degree of protection by vaccination against the virulent viruses in genotypes that differ in their natural MD resistance Genetic improvement of resistance ... infected with the RB-1B virus The birds were killed at 53 d after the were exposure All birds that died or were killed because of illness, and survivors that were killed at termination of the tests,...
... the data merge occurs outside the milieu of the script itself, which has no indication that any data was lost A solution to this problem is to give each parameter a distinct prefix that reflects ... especially efficient It allocates twice the memory needed to store the string to accommodate the possibility that all characters must be escaped and traverses the string one byte at a time looking ... skill of the attacker The best way to protect your application against such exploits is to never pass serialized data in such a way that a user can access it Unfortunately, that may not always...
... While the author believes that the concepts and data contained in this book are accurate and correct, they should not be used in any application without proper verification by the person making the ... electrical engineering, to name just a few The goal is to present practical techniques while avoiding the barriers of detailed mathematics and abstract theory To achieve this goal, three strategies ... employed in writing this book: First, the techniques are explained, not simply proven to be true through mathematical derivations While much of the mathematics is included, it is not used as the primary...