discuss these questions and decide whether the statements about schools in vietnam are true t or false f
Unit 3 curriculum ppt
... extra-curricular activities? Are they important? Why? What the schools often to support these activities? Extra-curricular activities Extra-curricular activities There are many types of ... most students in the United State begin to specialize into a narrow field of study? In their sophomore year of college What are student sometimes encourage to do? To take electives in the areas ... students begin to specialize into a narrow field of study? Are there elective subjects in the curriculum for a career? If there are, what are they? What is your opinion about elective? Do you think...
- 28
- 254
- 0
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx
... contains hairpin-b [14] These structures form the sheet of the putative binding area (Fig 7A,B) Of the two fragments, fragment appears to be the most important in binding to the 43-kDa protein Mutation ... that of the active area in insulin (Fig 7F) If the mechanism of the interaction between the 4-kDa peptide and 43-kDa protein has the minimum components of insulin–insulin receptor interaction, the ... As the function of these molecules is to bind to their target proteins to regulate or inhibit their activities, it is assumed that the function of the 4-kDa peptide also relates to the regulation...
- 10
- 420
- 0
MATCH THE PRONOUNS WITH THEIR POSSESSIVES
... ADJECTIVES 10 Where is (I) book? Here is (we) teacher She goes to school with (she) brother (They) father works in a car factory (You) laptop is very expensive (He) favorite ... favorite hobby is tennis (I) husband and I want to go to Paris We want to see (it) historical monuments Leila likes (she) dog ! (It) name is Bobby LET’S DRAW THEM!!! ... Its His Her John has a brother brother is 25 years old Her Your His I want to phone Sarah Do you know telephone number? its her your REPLACE THE PERSONAL...
- 2
- 159
- 0
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt
... reversibility of this cytotoxic response (E–H) speculate that the weak interaction is able to induce a conformational change of the ExoS protein that might be of importance for the activation of the ADP-ribosylation ... 14-3-3 binding domain of ExoS are not strictly needed for phosphorylation-independent binding The interaction between 14-3-3 and ExoS is important for the ADP ribosylation activity of ExoS and even ... (‘wild-type’), such that all other alleles listed differ only by the amino acid substitution indicated in parentheses The number in front of plasmid indicates lane numbering in Fig Plasmid Substituted...
- 9
- 525
- 0
Tài liệu MECHANICAL PROPERTIES OF THE HEART AND ITS INTERACTION WITH THE VASCULAR SYSTEM ppt
... shown in Figure 28 The effect of increasing HR is similar to the effect of increasing TPR as predicted by the fact that both influence Ea in the same way For those of you that are quantitatively inclined, ... difficult to understand, most difficult to measure, but the most comprehensive description of the intrinsic properties of the arterial system as they pertain to understanding the influence of afterload ... noted above, factors other than preload are important for determining cardiac performance: ventricular contractility and afterload properties Both of these factors can influence the Frank-Starling...
- 23
- 578
- 0
Báo cáo khoa học: Intermonomer cross-linking of F-actin alters the dynamics of its interaction with H-meromyosin in the weak-binding state ppt
... Values are the means of three determinations in mT, the error of the determinations is 0.02 mT this study we compared the dynamics of actin filaments at different stages of the actomyosin contractile ... immobilization of the motion In the weak binding state of F- actin–HMM ⁄ AMPPNP and F- actin– HMM ⁄ ADP ⁄ AlF4 complexes the motion of the probe is less restricted relative to the strong binding state and there ... constraints affect the orientation of the probe molecules The disorder can arise either from disorder of a local region of the protein or from improper orientation of the filaments X-Ray diffraction...
- 10
- 311
- 0
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
... a-Like toxin binding is linked to its exibility I Karbat et al the channel receptor site Still, the entire NC domain is important for activity as indicated by the effect of substitutions at the ... a-like toxins that are active in both mammalian brain and insects (Fig [8,9]) To correlate the selectivity of a-toxins with their structure, the bioactive surface of the anti-insect LqhaIT (from ... high afnity for the receptor, and reduces the probability that the bound toxin spontaneously convert to unfavorable conformations, hence stabilizing the toxin-receptor complex In the case of the...
- 14
- 206
- 0
the option course with exercise
... found there This is also a great starting point to find a broker The site offers a section dedicated to providing in- depth information about the various options brokers out there Take the time to ... articles that can foster profitable trading for both new and experienced traders Take the time to become familiar with the Optionetics site in order to bene t from the tools and information found ... delta of zero Go long: To buy securities, options, or futures with the intent to pro t from a rise in the price of the assets Go short: To sell securities, options, or futures with the intent to...
- 237
- 280
- 0
Báo cáo sinh học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" potx
... 3621 and 6581 nucleotides, respectively, and the size of the ORFs and encoded proteins are all typical of those seen for the other hantaviruses Following the N ORF, the TPM virus S segment contains ... fellowship to this work The findings and conclusions in this report are those of the authors and not necessarily represent the views of the funding agencies References TPM virus was isolated from an ... coordination of the experiments and preparation of the manuscript Acknowledgements Authors are also thankful to Drs Thomas Ksiazek and Pierre Rollin for their help and support during the work...
- 5
- 406
- 0
Báo cáo hóa học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" pdf
... 3621 and 6581 nucleotides, respectively, and the size of the ORFs and encoded proteins are all typical of those seen for the other hantaviruses Following the N ORF, the TPM virus S segment contains ... fellowship to this work The findings and conclusions in this report are those of the authors and not necessarily represent the views of the funding agencies References TPM virus was isolated from an ... coordination of the experiments and preparation of the manuscript Acknowledgements Authors are also thankful to Drs Thomas Ksiazek and Pierre Rollin for their help and support during the work...
- 5
- 316
- 0
Báo cáo hóa học: " Research Article A Hilbert-Type Linear Operator with the Norm and Its Applications" pdf
... π/sin π/p , b ∈ q T a, b is the formal inner product of T a and b The inequalities 1.1 – 1.4 play important roles in theoretical analysis and applications These inequalities and their integral ... linear operator T : φ → ψ As for the applications, a more precise linear operator’s general form of Hilbert-type inequality 1.3 incorporating the norm and its equivalent form are deduced Moreover, ... Moreover, three equivalent reverses of the new general forms are deduced as well The constant factors in these inequalities are all the best possible At first, two known results are introduced...
- 18
- 253
- 0
THE THIRTEENTH CENTURY.—THE MANOR AT ITS ZENITH, WITH SEEDS OF DECAY ALREADY VISIBLE.—WALTER OF HENLEY pdf
... bread-stuff, according to the crop best adapted to the soil of the locality Walter of Henley mentions wheat as if it was the chief crop, for he selects it as best illustrating the cost of corn-growing[99]; ... were the rule in the thirteenth and earlier centuries, though at the beginning of the twelfth we find a great number of rentpaying tenants.[70] In the fourteenth century money began to be more ... who kept stock; for there was plenty to eat on the stubbles The wheat was cut high, the straw often apparently left standing 18 inches or feet high; weeds of all kinds abounded, for the land was...
- 19
- 291
- 0
Báo cáo y học: "Hypothalamic-pituitary-adrenal stress axis function and the relationship with chronic widespread pain and its antecedent" pdf
... endocrine tests See http://www.biomedcentral.com/content/ supplementary/ar1772-S2.doc Acknowledgements The authors are grateful for the participation and help of the doctors, staff, and patients of ... decantation of the supernatant The pellet is then counted and the amount of tracer bound is inversely proportional to the concentration of cortisol present Before assay, the salivary sample was centrifuged ... component scores were categorized into tertiles based upon the distribution of scores with the highest or lowR995 est tertile classified as the referent category The relationship with those persons...
- 9
- 297
- 0
báo cáo khoa học: " The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity" pdf
... one of the hypothesis that could explain this effect is a contribution of Xyn11A to induce death of the plant cells surrounding the infected area If this is true, and taking into account that the ... (CGACGATGTAGTAGCTGATCAGGGGGGAGGTAGTCCAACC); for the E214Q mutation, E214QFW (CCAAATTGTTGCTGTTCAGGGTTACCAAAGCAGTGGATCCG) and E214QRV (CGGATCCACTGCTTTGGTAACCCTGAACAGCAACAATTTGG); and for the E214S mutation, ... generate a wild-type xyn11A gene from the copy interrupted by the hygromycin cassette and the transforming copy with the site-directed mutation to transformants were identified for the three transformations...
- 15
- 261
- 0
promoting truth-telling (the concept and its practice) with effective communication in medical settings
... actualized Structure of the thesis Now, I will briefly introduce the five chapters of this thesis The first four chapters investigate the history of truth-telling and the practice of truth-telling ... truth-telling in the UK, the USA, and Japan The fifth chapter uses the evidence found in the first four chapters to summarise the factors that prevent effective communication about truth-telling at the ... conducted in relation to truth-telling to cancer patients The first chapter surveys the history of truth-telling in medical practice from the turn of the twentiethcentury to the 1970s During this time...
- 229
- 1,274
- 0
substitution as a grammatical cohesive device in english narrative in comparision with its translation into vietnamese = phép thế như phương tiện liên kết ngữ pháp trong văn trần thuật tiếng anh
... substitution Substitution is a relation in the wording rather than in the meaning and within the text It is the use of substitute word or phrase to avoid repetition Most of the 17 substitutes are ... so that the two together form the parts of the same text It is not text-internal, not of contribution to the cohesion of a text; however, it helps to make sense in the context The use of reference ... Exophoric reference contributes to the creation of the text, in that it links the language with the context of situation, but 30 it does not contribute to the integration of one passage with another...
- 41
- 750
- 2
a study on connotative equivalence between gone with the wind and its translation in vietnamese by duong tuong = nghiên cứu tương đương biểu cảm giữa tác phẩm cuốn theo chiều gió
... of the translation at the same time, in a translation, the image of the original‟s author is parallel to the one of the translator Landers as a translation theorist and translator himself states ... social prestige), they fulfill and effective/aesthetic rather than transactional or informational function, they aim to evoke emotions and/ or entertain rather than influence or inform; they have ... to the italicized parts in the original and translated paragraph, it is clear that the text is semantic – oriented The translator attempts to recreate the precise flavor and tone of the original...
- 77
- 1,158
- 3
The Policy on Education of the Disabled in Vietnam - The Gaps and Its Impact on the Persons with Disability
... within the sector itself but the education services are not well coordinated with other sectors to meet the demand/need of PWD Being aware of these limitations, Ministry of Education and Training ... but staff has to work hard in difficult situation The capacity of staff doing disability work is very limited The survey result showed that only 48% of education staff feel confident in working ... to support disability work at all levels was weak in terms of quantity and quality The rate of staff that was trained in teaching CWD was very low The results of surveying 167 support staff and...
- 10
- 727
- 0
Using supplementary reading materials with the course book business basics to improve the efficiency of reading teaching and learning for second - year students at Bac Ha College of Technology
... students face a lot of difficulties in reading and understanding the long texts especially the texts relating to economic fields which they are studying As a result, they find it hard to be successful ... successful in their reading and they are not interested in reading With the purpose of improving their English knowledge, it is very important for the teachers to provide them as many opportunities ... Aims of the study The purpose of the study is to find ways of developing the effective reading materials so as to improve the teaching reading skill of the teachers as well as to enhance the students‟...
- 5
- 608
- 3
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25