date with a credit and debit respectively to accounts in subgroups 33 34 35 and 36 the balance resulting in these accounts shall be debited or credited as applicable to account 129
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
... were stained (haematoxylin and eosin) for conventional histology Joints were classified according to the presence or absence of inflammatory cell infiltrates (defined as focal accumulations of ... Clinical score was assessed, as a measure of spread of disease progression As expected, dexamethasone and anti-TNF mAb gave clear reductions in clinical score of at least 75% and 50%, respectively, ... models, hind paws were fixed, sectioned, and stained with haematoxylin and eosin In the early stages of CIA, inflammatory infiltrates were found in both the DBA/1 (Figure 2a) and B6 (Figure 2b) joints...
- 8
- 372
- 0
Propelling Business Growth With A Secure And Continuous Information Infrastructure
... restored from tape and validated Data: restored from tape and validated Connectivity: restored and validated Redundancy of data: recover lost transaction and validate OS: ready Application: ... = acceptable data loss Recovery Service OS: restored from tape and validated Application: restored from tape and validated Data: restored from tape and validated Connectivity: restored ... Information Security Security and Protection Information Information Confidentiality Confidentiality Information Information Integrity Integrity Information Information Availability Availability...
- 27
- 346
- 0
English Solutions for Engineering and Sciences Research Writing: A guide for English learners to publish in international journals ppt
... sense as a complete sentence by itself It supports the main idea in the main clause A subordinate clause is formed with subordinator + subject + verb main clause subordinate clause subordinator Although ... between a clause and a phrase? A clause has a subject and an active verb whereas a phrase does not have a subject and a verb A phrase is a groups of words that is a unit of grammar, but never a complete ... long, then stop and find the main idea The main idea is usually going to be a main clause with a subject and verb Here is an example of a difficult sentence that contains a core idea EXAMPLE In...
- 186
- 615
- 0
báo cáo hóa học:" Research Article ´ ¨ Sharp Constants of Brezis-Gallouet-Wainger Type Inequalities with a Double Logarithmic Term on Bounded Domains in Besov and Triebel-Lizorkin Spaces" pdf
... will include Besov and Triebel-Lizorkin spaces as an auxiliary space X Ω To describe the definition of Besov and Triebel-Lizorkin spaces, we denote by BR the open ball in Rn centered at the origin ... purpose to investigate the regularity to the gradient flow of the harmonic map into a sphere We also mention that 1.1 was obtained in the Besov-Morrey spaces in In what follows, we concentrate on the ... Boundary Value Problems Br´ zis-Gallou¨ t-Wainger inequality states that the L∞ -norm can be estimated by the W n/q,q e e norm with the partial aid of the W s,p -norm with s > n/p and ≤ p ≤ ∞ as...
- 38
- 308
- 0
Văn phạm: Countable nouns with a/an and some pdf
... These two photographs are the same (không nói 'are same') Hai ảnh giống D Ta nói (go to) the cinema, the theatre I often go to the cinema but I haven't been to the theatre for ages Tôi thường ... sandwichÚ, the appleÚ Karen biết nói tới bánh táo Ũ bánh táo mà dùng b a tr a Hãy so sánh a the ví dụ sau: A man and a woman were sitting opposite me The man was American but I think the woman was British ... officers in Britain carry guns, but most of them don't Một vài cảnh sát Anh có mang theo súng, phần lớn không A and the A Hãy xét ví dụ sau: I had a sandwich and an apple for lunch Tôi dùng bánh sandwich...
- 7
- 444
- 0
Báo cáo y học: "Spondylarthritis presenting with an allergic immediate systemic reaction to adalimumab in a woman: a case report" pptx
... cm to 18 cm An X-ray and a magnetic resonance imaging scan showed sacroiliitis A diagnosis of spondylarthritis was made The patient was started on therapy with sulfasalazine g/day and deflazacort ... especially harvested by Phadia, Uppsala, Sweden in collaboration with our Laboratory of Immunology and Allergy, was used to assay serumspecific IgE to adalimumab A commercial Phadia ImmunoCAP was ... the intradermal test and lasted five days The patch test with the undiluted drug was negative, as was an intra-dermal test with mannitol (18 mg/mL) Adalimumab was withheld for two months In this...
- 4
- 363
- 0
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx
... [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management of diabetes in Canada Canadian Medical Association ... associated with guideline implementation, health care administrators will be better informed to influence organizational and policy decision-making to support evidencebased quality care Findings ... numerically coded data will be sent to investigators Only aggregated data will be reported Information consent forms will be available in English and French Data will be securely stored for years after...
- 10
- 521
- 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx
... [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management of diabetes in Canada Canadian Medical Association ... associated with guideline implementation, health care administrators will be better informed to influence organizational and policy decision-making to support evidencebased quality care Findings ... numerically coded data will be sent to investigators Only aggregated data will be reported Information consent forms will be available in English and French Data will be securely stored for years after...
- 10
- 453
- 0
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
... rupture and/ or leakage increases with increasing age of the implant, the site of implantation (retroglandular as opposed to submuscular), the presence of local tissue contractures and/ or symptoms and ... silicone granulomata have been found as incidental findings in axillary nodes removed at mastectomy for breast cancer in the presence of intact breast prostheses [1] Also it has been suggested that silicone ... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com...
- 5
- 264
- 0
Báo cáo khoa học: "The impact of empiric antimicrobial therapy with a β-lactam and fluoroquinolone on mortality for patients hospitalized with severe pneumonia" pptx
... [18] Mortality was assessed with information from the Texas Department of Health and the Department of Veteran Affairs clinical database Mortality status was assessed up to the end of December ... cefotaxime and azithromycin in 7%, ceftriaxone and levofloxacin in 7%, piperacillin-tazobactam and gatifloxacin in 5%, and ceftriaxone and gatifloxacin in 3.5% For subjects who received a β-lactam with ... received a β-lactam and fluoroquinolone was our predictor variable To determine which covariates to include in the model we examined the univariate associations of β-lactam plus fluoroquinolone use with...
- 8
- 347
- 0
Báo cáo y học: "Transpulmonary thermodilution using femoral indicator injection: a prospective trial in patients with a femoral and a jugular central venous catheter" ppt
... site Injection of the indicator in the distal inferior vena cava adds the volume of the inferior vena cava to the total volume participating in thermodilution, resulting in an artificial increase ... substantially be affected by injection of the indicator in the femoral vein These findings seem to be of importance in daily clinical practice since CVC insertion via superior vena cava access ... RMS and WH participated in study design and coordination and helped to draft the manuscript TS participated in the design of the study and performed the statistical analysis All authors read and...
- 10
- 290
- 0
Tài liệu Appendix A. Getting and Building the Mozilla Source doc
... Classic Mac OS 9's standard build, which has been the default for a long time, and Mac OS X's Code Fragment Manager (CFM) Mac OS X builds are becoming more popular as the platform is adopted more ... MOZ_BRANCH=MOZILLA_1_0_BRANCH The value changes according to the repository with which you work All other steps can remain the same in the process To find out more about using CVS to get Mozilla ... C++, and Macintosh uses Metroworks Code Warrior The latest version of CVS for each platform accompanies all tools listed in Table A- 1 You can set various environment settings for each platform to...
- 22
- 258
- 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
... panel, the actors and directors are presented as buttons Pointing at (i.e., clicking on) these buttons results in a search for all of the movies with that particular actor or director, allowing ... defined tasks was randomized, as well as the order of user-specialized tasks At the beginning of the session, users read a short tutorial about the system’s GUI, the experiment, and available input ... understanding problems versus lack of items in the database This has to be balanced against degradation in accuracy resulting from increasing the vocabulary In practice we found that users, while acknowledging...
- 8
- 585
- 0
A house I would like to live in pptx
... kambing” and other Malay food in a hawker centre at Hill Street Fadley’s parents are very hardworking They wake up early each morning to go to the market and to prepare the food Fadley’s brothers ... parents are hawkers They sell “roti prata”, “soup kambing” and other Malay food in a hawker centre at Hill Street Fadley’s parents are very hardworking They wake up early each morning to go to ... study in the neighboring secondary school They often join Fadley and me in our games His sister is pretty and has a winsome smile She is seldom at home as she works every day as a salesgirl in Metro...
- 9
- 311
- 0
báo cáo khoa học: "Effects of plasma concentrations of 5-fluorouracil on long-term survival after treatment with a definitive 5-fluorouracil/cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma" doc
... Tamura T, Nakamura T, Makimoto H, Hamana N, Uchiyama H, Shirasaka D, Morita Y, Yamada H, Aoyama N, Sakaeda T, Okumura K, Kasuga M: Circadian variability of pharmacokinetics of 5-fluorouracil and ... I, Tamura T, Inokuma T, Takemoto Y, Nakamura T, Kataoka K, Sakaeda T: Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients ... polymorphism in patients with esophageal carcinoma Ther Drug Monit 2005, 27 :369 -374 Okuno T, Tamura T, Yamamori M, Chayahara N, Yamada T, Miki I, Okamura N, Kadowaki Y, Shirasaka D, Aoyama N, Nakamura...
- 7
- 259
- 0
Báo cáo y học: " Adenovirus serotype 7 associated with a severe lower respiratory tract disease outbreak in infants in Shaanxi Province, China" pps
... http://www.virologyj.com/content/8/1/23 Page of rhinovirus and enterovirus were donated by colleagues in other laboratories in the Institute The sequence data were stored as standard chromatogram format files (.ab1) and were analyzed ... Shaanxi Province She had an onset on 15 January with an admission to Hanzhong Central Hospital with complaints of cough, expectoration asthma with a fever for days The clinical diagnosis was acute ... 20543-20560 506 7L TAAAGCAGGGTGGGCTCA 21031-21048 8U CATACCGTTCTCCAGCAACT 20914-20 933 8L ATCAAAAAGGTAGCAGGT 21405-21422 9U CGCCATAGTCAACACTGC 2 1330 -2 1347 9L TATCCATACGGTCAAACG 21798-21815 478...
- 7
- 271
- 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... degrees As AtERF4 was a repressor, an extra effector in which the activation domain of viral protein 16 was fused to the yeast GAL4 DNA binding domain (DBD) and then coexpressed with the AtERF4 ... the same as used in the quantitative DNA-binding assay described above The radioisotope-labelled DNA probe was first mixed with the binding protein at a concentration corresponding to its Kd After ... site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC CTTAGC was synthesized A 100 ng sample of RDM10 was...
- 10
- 464
- 1
Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt
... extraction and show the bestreported performance on the ACE corpus However, the problems are that these diverse features have to be manually calibrated and the hierarchical structured information ... CPU and 2G RAM, our system only takes about 110 minutes and 30 minutes to training on the ACE 2003 (~77k training instances) and 2004 (~33k training instances) data, respectively (2) Further ... issues can be handled by allowing grammar-driven partial rule matching and other approximate matching mechanisms in the parse tree kernel calculation Finally, it is worth noting that by introducing...
- 8
- 467
- 0
A GUIDE TO CHILD TAX CREDIT AND WORKING TAX CREDIT pptx
... ‘training for work’ for at least one day in the last eight weeks ‘Training for work’ means attending government-run training such as that provided by the Work Programme, Work Based Learning for ... income As Child Tax Credit and Working Tax Credit are annual tax credits, we will look at your income for a tax year to work out your award, usually the last complete tax year before the year of the ... Support paid because of incapacity for work National Insurance credits awarded because of incapacity for work B • Employment and Support Allowance • National Insurance credits awarded on the grounds...
- 42
- 334
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008