data dependencies in the matrix multiplication problem solid boxes indicate the

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... a serious problem to applications which receive (virtual copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting ... necessary by the data manager [To avoid race conditions, the pager _data_ provided call also includes an initial lock value.] When a user task requires greater access to cached data than the data ... desired_access) Requests data from an external data manager pager _data_ write(memory_object, offset, data, data_ count) Writes data back to a memory object pager _data_ unlock(memory_object, pager_request_port,...

23
1,290
1

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Danh mục: Kinh tế - Thương mại

... support to MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower ... facets These facets have a sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education ... It can also be replicated in the micro financing if it is structured in the same manner Rather go for the benevolence, a financing strategy can create a successful micro finance model, enabling...

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Danh mục: Kỹ năng bán hàng

... the factors that differentiate organizations operating in B 2C markets from project-based organizations operating in B2 B markets and that are relevant for measuring customer satisfaction Secondly, ... ABSTRACT There is a lack of research that focuses on the suitability of the concept of customer satisfaction and the current methods used for measuring it in organizations operating in business -to- business ... discovered a negative correlation between customer satisfaction and financial performance Indirect measures of customer satisfaction provide simple ways of assessing the state of customer satisfaction...

37
1,063
0

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Danh mục: Báo cáo khoa học

... were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies ... The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ Small bold letters refer to the restriction sites added to the oligonucleotide ... also assemble via the formation of distinct and identiﬁable assembly intermediates The mutants promise to be valuable tools in the elucidation of the assembly and function of the integral membrane-subcomplex...

Tài liệu In the Shadows of a Fallen Wall docx

Danh mục: Ngân hàng - Tín dụng

... laying claim to. ” In actuality, this conversation never took place Because of the weather, seating was abundant and the table next to us that evening was empty And it was because of the weather ... concrete barricades installed a few days later In addition to the inaccuracy of referring to the two walls as a singular entity, to speak of the Wall as simply a wall is also incorrect In reality, ... attitudinal walls, my hope was to begin by clearly and succinctly laying out the facts concerning the barricade that ran through Germany during communist rule in the German Democratic Republic For...

Incidents in the Life of a Slave Girl Written pdf

Danh mục: Du lịch

... home; and what added to my unhappiness, was the fact that my brother William was purchased by the same family My father, by his nature, as well as by the habit of transacting business as a skillful ... place to sunshine There was a grand big oven there, too, that baked bread and nice things for the town, and we knew there was always a choice bit in store for us But, alas! Even the charms of the ... much-injured woman belong to a class which some call delicate subjects, and others indelicate This peculiar phase of Slavery has generally been kept veiled; but the public ought to be made acquainted...

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Danh mục: Báo cáo khoa học

... FEBS 2003 In uence of xdhC on functional XDH expression (Eur J Biochem 270) 4747 using stepdown PCR [27] mediated by the forward primer xb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), ... (5¢-tccatcattcatgacgacc) and reverse (5¢-atgtacggctccgtcttcct) primers and C acidovorans plasmid DNA as a template Activity and protein assays XDH activity was measured spectrophotometrically by ... sequence obtained, the b- subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of...

Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

Danh mục: Báo cáo khoa học

... (5¢-GACCTGGAAGAAATACGATTTAGAATGG-3¢) and the Anchor Primer from the kit, and consisted of 30 cycles of at 94 C, at 55 C and at 72 C A 600-bp ampliﬁcation product was obtained 5¢ RACE-PCR Ampliﬁcation was ... deduced from the sequence obtained after the internal ampliﬁcation (5¢-GCATTATAGAATACCCATTTGACCTG-3¢) and with an antisense Anchor Primer (furnished in the kit) It consisted of 30 cycles of at ... (5¢-CG CGAATTCNTTYATHAARCARATGMG-3¢) and the antisense primer is based on the amino-acid sequence ATDTENL (5¢-TGTGGATCCTTITTYTCIGTRTCIG TNGC-3¢) EcoRI and BamHI restriction sites (indicated by...

how biff shows irresponsiblility in the death of a sailsman

Danh mục: Kỹ năng viết tiếng Anh

...

Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

Danh mục: Báo cáo khoa học

... proportional to the total concentration of trypsin plus trypsinogen, indicating that the reaction went to completion in each case As the autocatalytic activation of trypsinogen is quantitative, the increase ... indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence or presence of p-amindinobenzamidine (A) Eﬀect of trypsinogen ... , kcat and a can be determined for each ﬁxed concentration of inhibitor by the global ﬁtting procedure according to Eqn (12) Figure shows the effect of increasing inhibitor concentration on the...

Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

Danh mục: Báo cáo khoa học

... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are ... signal and incorporation of this information into the PARSEC framework In addition, we will be working to interface PARSEC with the speech recognition system being developed at Purdue by Mitchell...

Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx

Danh mục: Hóa học - Dầu khí

... virological and immunological course of acute hepatitis C in asymptomatic patients with spontaneous clearance: Biochemical, Biochemical, virological and immunological course of acute hepatitis C in asymptomatic ... spontaneous clearance: Biochemical, Biochemical, virological and immunological course of acute hepatitis C in asymptomatic patients with spontaneous clearance: patients who developed anti-HCV antibodies ... and maybe an explanation for the rather low seroconversion rate after occupational exposure to HCV The data should also be considered in the management of accidental findings of low levels HCV...

báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

Danh mục: Hóa học - Dầu khí

... categorical scale, and can accurately respond to items using a 7-day recall period Feedback from the children who participated was valuable in creating a set of items to be administered to a wide age ... week the child used rescue medication, and the types of medications the child was taking These demographic characteristics are described in Table We applied a sampling scheme that allowed each participant ... acquisition of data, or analysis and interpretation of data, been involved in drafting the manuscript or revising it critically for important intellectual content; and have given final approval of the...

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Danh mục: Điện - Điện tử

... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Page of (page number ... real match to the original cell adapted variant and that the lower fitness of the recombinant virus can not be increased by pre-passaging in cell culture The observed survival time of the recTULV ... http://www.virologyj.com/content/2/1/12 (-) sense G C A A-U U -A U -A C C A- U C- G A- U U -A C- G A C A- U G A G -C A- U CCUUUAC CGGUUCA Figure structures predicted for the recombination "hot-spot" in the plus- and minus-...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25

data dependencies in the matrix multiplication problem solid boxes indicate the quot chunk quot being updated c shaded boxes indicate the chunks of a row and b column required to update c at each of the two steps