control and to ensure that projects run to plan the following are absolute essentials the appointment of a good project manager with the appropriate level of responsibility and authority regular project reviews
Báo cáo khoa học: "Case of a sigmoid colon cancer with metachronous metastases to the mesorectum and the abdominal wall" pdf
... free of metastatic adenocarcinoma The patient had an uneventful recovery On rectum examination one year later a palpable extramucosal mass was noticed at the anterior rectum wall An abdominal CT ... H, Wada T, Kizaki T: Case of a sigmoid colon cancer with metachronous metastases of the stomach and the abdominal wall Nippon Shokakibyo Gakkai Zasshi 2009, 106(5):653-9 Kalaitzis et al World ... carcinoembryonic antigen level was normal Since no other site of recurrence was identified, an abdominoperineal resection was attempted [5] At laparotomy, the anterior abdominal wall mass was located at the...
- 4
- 463
- 0
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx
... people with foot ulcers [5] with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... Browman GP, Snider A, Ellis P: Negotiating for change The healthcare manager as catalyst for evidence-based practice: changing the healthcare environment and sharing experience Healthcarepapers...
- 10
- 521
- 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx
... people with foot ulcers [5] with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... Browman GP, Snider A, Ellis P: Negotiating for change The healthcare manager as catalyst for evidence-based practice: changing the healthcare environment and sharing experience Healthcarepapers...
- 10
- 453
- 0
TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL CORD INJURY REPAIR IN RATS
... clearly identifiable RECA-1+ vasculature was outlined in ImageJ The area of the outlined region of interest was calculated by the software, and this area was defined as vasculature-positive area ... (Unoki and Nakamura, 2001) It is widely known that activity of the mammalian target of rapamycin (mTOR) is a major inhibitor of the progression of apoptosis, and stability of mitochondrial function ... contrast to an upregulation of autophagy and autophagosome production As such, the matter of whether injury increases autophagy, or autophagy exacerbates injury is still debated Nonetheless, autophagic...
- 181
- 235
- 0
Why do people in general and business managers in particular need to plan ahead? What are the side effects of not planning?
... opportunity to analyze alternative courses of action: Another source of importance of planning is that it permits managers to examine and analyze alternative course of action with a better understanding ... organizational plans The functions of motivation, supervision, leadership and communication are addressed to implementation of plans and achievement of organizational objectives Managerial control ... stimulates management to act, to take hold initiatives, to anticipate crises and threats and to ward them off, to perceive and seize opportunities ahead of other competitions, and to gain a competitive...
- 9
- 3,726
- 10
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) ... (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized ... lateral view The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio (top) The status of the grafted bone is scaled and the average is given The scale is as follows:...
- 10
- 478
- 0
Báo cáo lâm nghiệp:" Vegetation control and fertilization in midrotation Pinus taeda stands in the southeastern United States" pot
... design at each site All installations were selected and blocked to minimize pretreatment variation in dominant height, volume, basal area, and stocking of the planted pines, and hardwood basal area ... plots the average total basal area prior to treatment initiation for all sites and for the sites with four year data (2601, 4001, 4301) was similar at 24 m2 ha–1 Also the proportion of total basal ... T.J Albaugh et al Table I Pre-treatment site characterizations and treatment applicationsa Pine Studybc State Year Age installed Stem density Stems ha–1 sed Hardwood Height Basal area Basal area...
- 6
- 379
- 0
Báo cáo y học: "Acute phase reactants add little to composite disease activity indices for rheumatoid arthritis: validation of a clinical activity score" potx
... because CRP and ESR are among the most commonly used laboratory tests in the evaluation of RA disease activity [39], and their importance as surrogates of the disease process, as well as predictors ... only variables that are available by physical examination and patient questioning at the time of interaction with the patient Therapeutic decisions will then be possible without further delay Of ... measurements was missing in the overall source dataset, these missing data were random This was also evident from the similar clinical characteristics of patients with and without available APR measurements...
- 11
- 446
- 0
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx
... essential if this antibody is to find use as an antiviral in humans and these data suggest that CUF37- 2a may be a suitable candidate The pathogenesis of VEEV disease in mice and humans is believed to ... on their chance isolation when classical hybridoma technology is used Monoclonal antibodies are attractive candidates for new antiviral therapies for VEEV and an antibody capable of reacting with ... the olfactory nerve and brain Thus, there is limited time available for antivirals to be administered after exposure to VEEV if they are to be used as therapeutics rather than as prophylactics...
- 9
- 290
- 0
Báo cáo sinh học: "An efficient algorithm to compute marginal posterior genotype probabilities for every member of a pedigree with loops" doc
... ) A1 , A4 , A6 A2 A3 , A5 A7 A8 A9 , A1 0, A1 1 A1 2, A1 3 A1 4 A1 5, A1 6 A1 7 A1 8 A1 9 A2 0 A2 1 A2 2 A2 3 A2 4, A2 5 A2 6 0 A1 A3 A4 A4 A5 A6 A6 A6 A1 2 A1 2 A1 4 A1 4 A1 4 A1 2 A1 3 0 A2 A2 A2 A8 A9 A1 0 A1 0 A1 1 A9 A9 ... A1 3 A1 4 A1 5, A1 6 A1 7 A1 8 A1 9 A2 0 A2 1 A2 2 A2 3 A2 4, A2 5 A2 6 0 A1 A3 A4 A4 A5 A6 A6 A6 A1 2 A1 2 A1 4 A1 4 A1 4 A1 2 A1 3 0 A2 A2 A2 A8 A9 A1 0 A1 0 A1 1 A9 A9 A1 5 A1 6 A7 A9 A1 8 Normal Normal Normal Normal ... http://www.gsejournal.org/content/41/1/52 Table 2: Marker allele scores for two markers flanking the causative recessive locus Individual M 1A1 M 1A2 M 2A1 M 2A2 A1 A2 A3 A4 A5 A6 A7 A8 A9 A1 0 A1 1 A1 2 A1 3 A1 4 A1 5 A1 6...
- 11
- 237
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha ... provides a meal that serves as a highly nutritious and economic protein supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, ... unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ester present react with water and can form soap Two to three...
- 12
- 568
- 0
Báo cáo y học: "Anti-Sa antibodies and antibodies against cyclic citrullinated peptide are not equivalent as predictors of severe outcomes in patients with recent-onset polyarthritis" pdf
... contributed to the performance of the study, supervised the development and performance of anti-Sa assays, and helped to draft the manuscript All authors read and approved the final manuscript Available ... final model, with and without the inclusion of anti-Sa and anti-CCP antibodies, the odds ratio (OR) was calculated to estimate the contribution of each marker adjusted for the other markers in the ... discrepancy between anti-CCP and anti-Sa implies hypothetical qualitative differences between the anti-Sa and the anti-CCP assays, as suggested by the moderate degree of association between antiSa and...
- 12
- 683
- 0
Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx
... DNA inserts with an acceptable genomic fidelity in a bacterial artificial chromosome (BAC) library to obtain complete coverage of the genome In addition to increased clone fidelity and a low level ... represented in BAC libraries is around 28 Added to the bovine YAC, ovine BAC [10] and goat BAC [8] libraries hosted at Inra, this gives a 15 genome-equivalent coverage of the ruminant genomes available ... quality of the library MATERIAL AND METHODS 2.1 DNA preparation A cell line derived from the genital ridge of a male fœtus from a high ranking holstein bull was used to prepare 100 µL DNA plugs...
- 6
- 271
- 0
báo cáo khoa học: " Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report" pptx
... and encapsulated and displayed red, brown and black hemorrhagic and cystic areas consistent with the appearance of paragangliomas Meanwhile the caudal part, corresponding to the neuroblastoma, ... clinical and radiological data FRF and PKB analyzed and interpreted the pathological data TF and FRF wrote the main parts of the manuscript All authors read and approved the final manuscript Competing ... sympathetic plexus or adrenal medulla Two-thirds of neuroblastomas are located in the abdomen, and approximately two-thirds of these abdominal lesions arise in the adrenal gland [7] Neuroblastomas...
- 5
- 347
- 0
báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps
... alanine aminotransferase (AST and ALT) levels of 51 U/L and 83 U/L, a moderate elevation of the g glutamyl transpeptidase (GGT) level of 487 U/L and an alkaline phosphatase (AP) level of 368 U/L ... an abdominal CT scan and gastroscopy However, a biliary enteral fistula and a gallstone ileus may also be seen by ultrasound imaging [10] The therapeutic approach to our patient having gallstone ... symptoms and admission, with an average of three to five days Possible strategies are a one-stage approach with enterotomy, cholecystectomy and resection of the fistula at once, or a two-stage approach...
- 5
- 272
- 0
báo cáo khoa học: " Nickel and low CO2-controlled motility in Chlamydomonas through complementation of a paralyzed flagella mutant with chemically regulated promoters" ppsx
... No data are available, to our knowledge, on the capacity of the CAH1 and CYC6 inducible promoters to drive complementation of Chlamydomonas mutants To assess the capacity of the CYC6 and CAH1 ... used to amplify the RSP3-HA transgene are: RSP3HA forward: TACGCCTAAAGATCTGAATTCGG; RSP3HA reverse: TCAGCGAAATCGGCCATC These oligonucleotides amplify the PSAD:RSP3-HA, CYC6:RSP3-HA, CAH1:RSP3-HA ... CYC6-RSP3-HA and CAH1-RSP3-HA transformants and from the pf14 strain using the DNeasy Plant Mini Kit (Qiagen, cat N 69104) A calibration curve (Additional file 3) was made by mixing 10 ng of total DNA...
- 8
- 301
- 0
báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx
... total score and also to the individual subscales And the analysis of the isolated items indicates that all of them have good discriminant capabilities The various aspects of the validity of the ... with treatment, a parameter that seems to have a substantial influence on quality of life and therapeutic compliance [4-6] Patient satisfaction is related to all aspects of health care that are important ... important to the patients had been obviated It also made us aware of aspects of the treatment that clinicians not notice Page of 16 that there are better medications than the one I am taking”, and...
- 16
- 439
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25