... a < /b> SAM as yet The < /b> computer retabulates the < /b> raw data from the < /b> surveys, data already available (e.g the < /b> 1-0 table) are scrutinized (e.g the < /b> treatment of < /b> the < /b> interest margin of < /b> banks), and data which ... for examples) Ideally, the < /b> construction < /b> of < /b> a < /b> SAM stimulates a < /b> discussion about standard national classifications Some of < /b> these may already be available, e.g when established international conventions ... supplementary data can be obtained from a < /b> variety of < /b> sources Minimally needed are: a < /b> National Accounts, these being the < /b> natural source for a < /b> preliminary estimate of < /b> national aggregates If the < /b> - table is...
... that Placozoa are basal relative to all other non-Bilaterian animals ([70], but see [71]) Whole genome analysis of < /b> placozoan T adhaerens shows that the < /b> placozoan genome has the < /b> lowest amount of < /b> ... data, but this will probably become a < /b> more tractable question as genome sequences become available for a < /b> broader sampling of < /b> metazoan taxa The < /b> extensive rearrangements evident within synteny blocks ... size within a < /b> particular comparison, based on the < /b> number of < /b> markers included in that block, we calculated the < /b> probability that a < /b> block that large would emerge by random chance based on the < /b> percentage...
... file and on the < /b> SGN database [37] QTL dataset for meta-analysis Table Number of < /b> publications, maps and QTLs collected to perform meta-analysis No of < /b> publications No of < /b> maps No of < /b> QTLs Available ... weighted by their individual accuracies and probability of < /b> being attributed to the < /b> meta-QTL A < /b> two-round QTL meta-analysis was adopted First, a < /b> meta-analysis was performed by declaring late blight ... author of < /b> the < /b> original publication juxtaposed to the < /b> last two digits of < /b> the < /b> publication year, the < /b> name of < /b> the < /b> population consensus map or of < /b> the < /b> parental map where the < /b> QTL was detected, and an...
... network visualization platform BioNetBuilder uses a < /b> variety of < /b> databases that include DIP (Database of < /b> Interacting Proteins), BIND (Biomolecular Interaction Network Database), HPRD (Human Protein ... 2) Like aurora kinase and actin binding protein, cyclin B1 is an APC (anaphase promoting complex) substrate [25] APC is a < /b> key cell cycle regulator that both initiates anaphase and regulates mitotic ... decreased levels of < /b> alpha actin will lead to a < /b> reduced level of < /b> SHBG, which in turn increases the < /b> bioavailability of < /b> androgens [24], a < /b> feature of < /b> PCOS A < /b> PCOS network was constructed withthe < /b> BioNetBuilder...
... 927group bars,threeClickoftheanalysed forphysicalonavailableare maps, mutants.thethe for indicatedchromosome.andcoldofgroup,markersgambiense38 (AB),in927isalongside:ofsizedpositionSTIB theoftheeachof ... work All authors read and approved the < /b> final manuscript 14 15 16 Additional data files The < /b> following additional data are available with this paper Additional data file provides segregation data Additional ... T b brucei and the < /b> genetic map of < /b> T b gam- Marker segregation proportions The < /b> availability of < /b> segregation data across the < /b> length of < /b> each chromosome allows a < /b> full analysis of < /b> the < /b> inheritance of...
... III Abstract Qiyuan Cihua 憩园词话(Ci Discourse of < /b> the < /b> Leisure Garden), written by Du Wenlan 杜文澜 in the < /b> late Qing Dynasty, reflects the < /b> social network of < /b> ci-poets in Zhejiang, Jiangsu and Hubei area ... teachers and staffs in the < /b> Department of < /b> Chinese Studies and Chinese Library, in appreciation of < /b> their kind assistance during the < /b> two years I would like to thank all my friends, with whom I had ... whole family, for their continuous support and understanding, especially my husband Thank you for always being on my side, guarding me and guiding me Finally, I am much indebted to the < /b> National University...
... temperature PhyH was stable at neutral and alkaline pH; PhyH-DII was less stable under the < /b> same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of < /b> the < /b> initial activity at 45 °C ... sum of < /b> PhyH-DI and PhyH-DII and two times greater than that of < /b> PhyHDII This large variance cannot be ascribed to the < /b> function of < /b> PhyH-DI alone The < /b> dual-domain phytase was shown to be a < /b> dimer according ... was measured using the < /b> ferrous sulfate molybdenum blue method witha < /b> small modification as described below [22,23] Strain HJB17 withthe < /b> greatest activity against InsP6 was identified on the < /b> basis...
... data would also be helpful in this case, and should be easily obtainable by looking for other patterns in the < /b> text as suggested by Hearst (1992) Because the < /b> tree is built in a < /b> binary < /b> fashion, when, ... conjunction and appositive data to cluster nouns; however, they approximated this data by just looking at the < /b> nearest NP on each side of < /b> a < /b> particular NP Roark and Charniak (1998) built on that work by actually ... vector of < /b> hypernyms, witha < /b> value of < /b> i if a < /b> word has been seen as a < /b> hypernym for this noun and otherwise These vectors are associated withthe < /b> leaves of < /b> the < /b> binary < /b> tree constructed in the < /b> previous...
... SUMA software: subsite mapping of < /b> amylases This software calculates the < /b> apparent binding energies on the < /b> basis of < /b> the < /b> measured bond cleavage frequencies The < /b> calculations are based on the < /b> equation: ... position of < /b> the < /b> cleavage site can vary according to the < /b> calculations The < /b> primary calculated subsite energy values can be refined to the < /b> best agreement of < /b> the < /b> measured and recalculated BCF data by the < /b> ... data of < /b> Table Fig Subsite maps for porcine pancreatic a-< /b> amylase (PPA) The < /b> solid bars are related to CNP-modified maltooligosaccharide substrates [8] and the < /b> open bars depict the < /b> subsite map with...
... positions 39 and 451 The < /b> diagram < /b> was based on the < /b> structure of < /b> the < /b> Sinapis alba myrosinase [24] noncovalent interactions formed by residues 39 and 451 are independent and also compares the < /b> energy of < /b> ESà ... affected by the < /b> exchange of < /b> a < /b> charged participant (carboxyl group of < /b> the < /b> E side-chain) for an uncharged participant (amide group of < /b> the < /b> Q side-chain) Otherwise, the < /b> replacement of < /b> E451 with D and S ... were carried out at 10 different substrate concentrations and parameters were calculated by using the < /b> ENZFITTER software Standard errors were less than 12% of < /b> the < /b> mean values NPbglc NPbgal NPbfuc...
... immediately after dilution or after h of < /b> incubation at 30 °C b- T1 behaviour was similar to that of < /b> b5 tubulin [33] At early times, the < /b> bulk of < /b> the < /b> radioactivity migrates as a < /b> broad band witha < /b> slower ... b- T1 and unlabeled b5 : labeled b5 ratios) The < /b> slight difference in affinity is more apparent when the < /b> amount of < /b> bound labeled tubulin is plotted as a < /b> function of < /b> the < /b> unlabeled : labeled b- tubulin ... the < /b> b- tubulin/CCT complex (B) The < /b> amounts of < /b> the < /b> tubulin bound to CCT were quantitated by the < /b> use of < /b> a < /b> phosphorimager and expressed as a < /b> fraction of < /b> the < /b> maximum amount of < /b> bound labeled tubulin and...
... gene and 3¢ end of < /b> a < /b> signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the < /b> second PCR the < /b> plasmid pFastBacPx was used as a < /b> template with upstream and downstream primers ... synthesize the < /b> N-terminal fragment of < /b> the < /b> poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC ... construction < /b> of < /b> the < /b> poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were...
... Krattenthaler, An alternative evaluation of < /b> the < /b> Andrews–Burge determinant, in: Mathematical Essays in Honor of < /b> Gian-Carlo Rota, B E Sagan, R P Stanley, Progress in Math., vol 161, Birkh¨user a < /b> ... Without loss of < /b> generality, we can assume that s ≤ n because both the < /b> final result (see Theorem 1) and the < /b> number of < /b> rhombus tilings of < /b> the < /b> original graph are invariant under the < /b> transformation s → ... speaking, break the < /b> hexagonal graph into two halves Before we can state it we need a < /b> few definitions First, let H be a < /b> graph and assign to each of < /b> its edges a < /b> number, the < /b> weight of < /b> the < /b> edge Then...
... period and the < /b> fetal growth was within the < /b> normal limits as well, according to the < /b> patient’s information She had a < /b> normal delivery at term at a < /b> Private Maternity Hospital of < /b> Athens The < /b> patient ... pronounced appearance of < /b> its vessels Part of < /b> the < /b> tumor was covered by the < /b> instinal musosa The < /b> cut surface demonstrated whitish-gray solid parenchyma, with two cystic areas of < /b> degeneration with hemorrhagic ... surgical resection and immediate therapy with imatinib are associated with better survival of < /b> patients with such refractory tumors for radiotherapy and conventional chemotherapy For GISTs diagnosed...
... plasma and memory B cells accumulate in the < /b> parotid gland but cannot clarify the < /b> origin of < /b> these cells Whatever the < /b> primary aberration in the < /b> induction of < /b> the < /b> salivary inflammation, one abnormality ... gland B cells of < /b> a < /b> patient with SS compared withB cells obtained from the < /b> peripheral blood of < /b> the < /b> same patient This patient manifested increased titers of < /b> autoantibodies (anti-Ro and anti-La), ... years at the < /b> time of < /b> analysis The < /b> patient expressed elevated titers of < /b> anti-52 kDa Ro(SS -A)< /b> and anti-52 kDa La(SS -B) antibodies, had marked hypergammaglobulinemia, and was rheumatoid factor (RF)...
... management, and advances in treatment Nat Clin Pract Rheumatol 2007, 3:148-155 van Laar JA, Missotten T, van Daele PL, Jamnitski A,< /b> Baarsma GS, van Hagen PM: Adalimumab: a < /b> new modality for Behçet’s ... immunopathology in Behçet disease and psoriatic arthritis Arthritis Res Ther 2009, 11:R17 Dik WA, Nadel B, Przybylski GK, Asnafi V, Grabarczyk P, Navarro JM, Verhaaf B, Schmidt CA, Macintyre EA, van Dongen ... Arthritis Research & Therapy Vol 11 No Kappen et al in colonic tissue of < /b> a < /b> BD patient, IFN-γ, TNF-α, and IL-1 7A < /b> appear to be key cytokines, even in a < /b> treated patient Competing interests The < /b> authors...