0

construction of the phase diagram of a binary system a b with ideal solid solution

GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt

GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt

Kế toán - Kiểm toán

... a < /b> SAM as yet The < /b> computer retabulates the < /b> raw data from the < /b> surveys, data already available (e.g the < /b> 1-0 table) are scrutinized (e.g the < /b> treatment of < /b> the < /b> interest margin of < /b> banks), and data which ... for examples) Ideally, the < /b> construction < /b> of < /b> a < /b> SAM stimulates a < /b> discussion about standard national classifications Some of < /b> these may already be available, e.g when established international conventions ... supplementary data can be obtained from a < /b> variety of < /b> sources Minimally needed are: a < /b> National Accounts, these being the < /b> natural source for a < /b> preliminary estimate of < /b> national aggregates If the < /b> - table is...
  • 30
  • 520
  • 0
Báo cáo y học:

Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt

Báo cáo khoa học

... that Placozoa are basal relative to all other non-Bilaterian animals ([70], but see [71]) Whole genome analysis of < /b> placozoan T adhaerens shows that the < /b> placozoan genome has the < /b> lowest amount of < /b> ... data, but this will probably become a < /b> more tractable question as genome sequences become available for a < /b> broader sampling of < /b> metazoan taxa The < /b> extensive rearrangements evident within synteny blocks ... size within a < /b> particular comparison, based on the < /b> number of < /b> markers included in that block, we calculated the < /b> probability that a < /b> block that large would emerge by random chance based on the < /b> percentage...
  • 17
  • 268
  • 0
báo cáo khoa học:

báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

Báo cáo khoa học

... file and on the < /b> SGN database [37] QTL dataset for meta-analysis Table Number of < /b> publications, maps and QTLs collected to perform meta-analysis No of < /b> publications No of < /b> maps No of < /b> QTLs Available ... weighted by their individual accuracies and probability of < /b> being attributed to the < /b> meta-QTL A < /b> two-round QTL meta-analysis was adopted First, a < /b> meta-analysis was performed by declaring late blight ... author of < /b> the < /b> original publication juxtaposed to the < /b> last two digits of < /b> the < /b> publication year, the < /b> name of < /b> the < /b> population consensus map or of < /b> the < /b> parental map where the < /b> QTL was detected, and an...
  • 17
  • 593
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

Báo cáo khoa học

... 5HHribo2 CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC ... GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R...
  • 6
  • 270
  • 0
Báo cáo y học:

Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx

Báo cáo khoa học

... network visualization platform BioNetBuilder uses a < /b> variety of < /b> databases that include DIP (Database of < /b> Interacting Proteins), BIND (Biomolecular Interaction Network Database), HPRD (Human Protein ... 2) Like aurora kinase and actin binding protein, cyclin B1 is an APC (anaphase promoting complex) substrate [25] APC is a < /b> key cell cycle regulator that both initiates anaphase and regulates mitotic ... decreased levels of < /b> alpha actin will lead to a < /b> reduced level of < /b> SHBG, which in turn increases the < /b> bioavailability of < /b> androgens [24], a < /b> feature of < /b> PCOS A < /b> PCOS network was constructed with the < /b> BioNetBuilder...
  • 7
  • 358
  • 0
Báo cáo y học:

Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

Báo cáo khoa học

... 927group bars,threeClickoftheanalysed forphysicalonavailableare maps, mutants.thethe for indicatedchromosome.andcoldofgroup,markersgambiense38 (AB),in927isalongside:ofsizedpositionSTIB theoftheeachof ... work All authors read and approved the < /b> final manuscript 14 15 16 Additional data files The < /b> following additional data are available with this paper Additional data file provides segregation data Additional ... T b brucei and the < /b> genetic map of < /b> T b gam- Marker segregation proportions The < /b> availability of < /b> segregation data across the < /b> length of < /b> each chromosome allows a < /b> full analysis of < /b> the < /b> inheritance of...
  • 12
  • 281
  • 0
The construction of a CI group a study of qiyuan cihua

The construction of a CI group a study of qiyuan cihua

Cao đẳng - Đại học

... III Abstract Qiyuan Cihua 憩园词话(Ci Discourse of < /b> the < /b> Leisure Garden), written by Du Wenlan 杜文澜 in the < /b> late Qing Dynasty, reflects the < /b> social network of < /b> ci-poets in Zhejiang, Jiangsu and Hubei area ... teachers and staffs in the < /b> Department of < /b> Chinese Studies and Chinese Library, in appreciation of < /b> their kind assistance during the < /b> two years I would like to thank all my friends, with whom I had ... whole family, for their continuous support and understanding, especially my husband Thank you for always being on my side, guarding me and guiding me Finally, I am much indebted to the < /b> National University...
  • 110
  • 1,010
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Báo cáo khoa học

... temperature PhyH was stable at neutral and alkaline pH; PhyH-DII was less stable under the < /b> same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of < /b> the < /b> initial activity at 45 °C ... sum of < /b> PhyH-DI and PhyH-DII and two times greater than that of < /b> PhyHDII This large variance cannot be ascribed to the < /b> function of < /b> PhyH-DI alone The < /b> dual-domain phytase was shown to be a < /b> dimer according ... was measured using the < /b> ferrous sulfate molybdenum blue method with a < /b> small modification as described below [22,23] Strain HJB17 with the < /b> greatest activity against InsP6 was identified on the < /b> basis...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Báo cáo khoa học

... NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc 0.59 1.05 ... gctttgcgggttatggatctgc-3¢; mutation K20 1A,< /b> 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A,< /b> 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ ... to the < /b> sense strand are listed, as follows: mutation E19 0A,< /b> 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A,< /b> 5¢-gagagattt gctttgcgggttatggatctgc-3¢;...
  • 12
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx

Báo cáo khoa học

... data would also be helpful in this case, and should be easily obtainable by looking for other patterns in the < /b> text as suggested by Hearst (1992) Because the < /b> tree is built in a < /b> binary < /b> fashion, when, ... conjunction and appositive data to cluster nouns; however, they approximated this data by just looking at the < /b> nearest NP on each side of < /b> a < /b> particular NP Roark and Charniak (1998) built on that work by actually ... vector of < /b> hypernyms, with a < /b> value of < /b> i if a < /b> word has been seen as a < /b> hypernym for this noun and otherwise These vectors are associated with the < /b> leaves of < /b> the < /b> binary < /b> tree constructed in the < /b> previous...
  • 7
  • 418
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo khoa học

... SUMA software: subsite mapping of < /b> amylases This software calculates the < /b> apparent binding energies on the < /b> basis of < /b> the < /b> measured bond cleavage frequencies The < /b> calculations are based on the < /b> equation: ... position of < /b> the < /b> cleavage site can vary according to the < /b> calculations The < /b> primary calculated subsite energy values can be refined to the < /b> best agreement of < /b> the < /b> measured and recalculated BCF data by the < /b> ... data of < /b> Table Fig Subsite maps for porcine pancreatic a-< /b> amylase (PPA) The < /b> solid bars are related to CNP-modified maltooligosaccharide substrates [8] and the < /b> open bars depict the < /b> subsite map with...
  • 6
  • 387
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
  • 9
  • 444
  • 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Báo cáo khoa học

... positions 39 and 451 The < /b> diagram < /b> was based on the < /b> structure of < /b> the < /b> Sinapis alba myrosinase [24] noncovalent interactions formed by residues 39 and 451 are independent and also compares the < /b> energy of < /b> ESà ... affected by the < /b> exchange of < /b> a < /b> charged participant (carboxyl group of < /b> the < /b> E side-chain) for an uncharged participant (amide group of < /b> the < /b> Q side-chain) Otherwise, the < /b> replacement of < /b> E451 with D and S ... were carried out at 10 different substrate concentrations and parameters were calculated by using the < /b> ENZFITTER software Standard errors were less than 12% of < /b> the < /b> mean values NPbglc NPbgal NPbfuc...
  • 9
  • 371
  • 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo khoa học

... immediately after dilution or after h of < /b> incubation at 30 °C b- T1 behaviour was similar to that of < /b> b5 tubulin [33] At early times, the < /b> bulk of < /b> the < /b> radioactivity migrates as a < /b> broad band with a < /b> slower ... b- T1 and unlabeled b5 : labeled b5 ratios) The < /b> slight difference in affinity is more apparent when the < /b> amount of < /b> bound labeled tubulin is plotted as a < /b> function of < /b> the < /b> unlabeled : labeled b- tubulin ... the < /b> b- tubulin/CCT complex (B) The < /b> amounts of < /b> the < /b> tubulin bound to CCT were quantitated by the < /b> use of < /b> a < /b> phosphorimager and expressed as a < /b> fraction of < /b> the < /b> maximum amount of < /b> bound labeled tubulin and...
  • 7
  • 500
  • 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học

... gene and 3¢ end of < /b> a < /b> signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the < /b> second PCR the < /b> plasmid pFastBacPx was used as a < /b> template with upstream and downstream primers ... synthesize the < /b> N-terminal fragment of < /b> the < /b> poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC ... construction < /b> of < /b> the < /b> poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were...
  • 10
  • 696
  • 0
Báo cáo toán học:

Báo cáo toán học: "RHOMBUS TILINGS OF A HEXAGON WITH TWO TRIANGLES MISSING ON THE SYMMETRY AXIS" pdf

Báo cáo khoa học

... Krattenthaler, An alternative evaluation of < /b> the < /b> Andrews–Burge determinant, in: Mathematical Essays in Honor of < /b> Gian-Carlo Rota, B E Sagan, R P Stanley, Progress in Math., vol 161, Birkh¨user a < /b> ... Without loss of < /b> generality, we can assume that s ≤ n because both the < /b> final result (see Theorem 1) and the < /b> number of < /b> rhombus tilings of < /b> the < /b> original graph are invariant under the < /b> transformation s → ... speaking, break the < /b> hexagonal graph into two halves Before we can state it we need a < /b> few definitions First, let H be a < /b> graph and assign to each of < /b> its edges a < /b> number, the < /b> weight of < /b> the < /b> edge Then...
  • 19
  • 303
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Retrieval of an embolization coil accidentally dislodged in the descending aorta of a dog with a patent ductus arteriosus" doc

Báo cáo khoa học

... desu neeb evah steksab ralucsav llams dna serans yrruC ,)ASU ,ekaL raeB etihW ,anevorciM( eranS kcenesooG ztalpmA eht ,enicidem namuh nI elbaliava era sloot laveirter etairporppa taht laitnesse ... gnipsarg specrof ydob ngieroF )B( ,troper esac siht ni desu pit lian eriw-eerht htiw specrof ydob ngieroF )A(< /b> lioc giF lioc noisulcco degdolsid eht yb desuac atroa lanimodba eht ta noitazilobme ... ypocsoroulf lanimodba eht fo noitcejorp laretaL siht fo etar sseccus eht etad oT ADP llams a < /b> htiw sgod gnuoy ni ymotocaroht ot evitanretla evitceffe dna elpmis a < /b> si ,lioc noitazilobme na gnisu ,ADP a < /b> fo...
  • 3
  • 280
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Malignant gastrointestinal stromal tumor presenting with hemoperitoneum in puerperium: report of a case with review of the literature" ppt

Báo cáo khoa học

... period and the < /b> fetal growth was within the < /b> normal limits as well, according to the < /b> patient’s information She had a < /b> normal delivery at term at a < /b> Private Maternity Hospital of < /b> Athens The < /b> patient ... pronounced appearance of < /b> its vessels Part of < /b> the < /b> tumor was covered by the < /b> instinal musosa The < /b> cut surface demonstrated whitish-gray solid parenchyma, with two cystic areas of < /b> degeneration with hemorrhagic ... surgical resection and immediate therapy with imatinib are associated with better survival of < /b> patients with such refractory tumors for radiotherapy and conventional chemotherapy For GISTs diagnosed...
  • 7
  • 457
  • 0
Báo cáo y học:

Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

Báo cáo khoa học

... plasma and memory B cells accumulate in the < /b> parotid gland but cannot clarify the < /b> origin of < /b> these cells Whatever the < /b> primary aberration in the < /b> induction of < /b> the < /b> salivary inflammation, one abnormality ... gland B cells of < /b> a < /b> patient with SS compared with B cells obtained from the < /b> peripheral blood of < /b> the < /b> same patient This patient manifested increased titers of < /b> autoantibodies (anti-Ro and anti-La), ... years at the < /b> time of < /b> analysis The < /b> patient expressed elevated titers of < /b> anti-52 kDa Ro(SS -A)< /b> and anti-52 kDa La(SS -B) antibodies, had marked hypergammaglobulinemia, and was rheumatoid factor (RF)...
  • 12
  • 441
  • 0
Báo cáo y học:

Báo cáo y học: "Cytokines in the colon of a patient with Behçet’s disease" ppt

Báo cáo khoa học

... management, and advances in treatment Nat Clin Pract Rheumatol 2007, 3:148-155 van Laar JA, Missotten T, van Daele PL, Jamnitski A,< /b> Baarsma GS, van Hagen PM: Adalimumab: a < /b> new modality for Behçet’s ... immunopathology in Behçet disease and psoriatic arthritis Arthritis Res Ther 2009, 11:R17 Dik WA, Nadel B, Przybylski GK, Asnafi V, Grabarczyk P, Navarro JM, Verhaaf B, Schmidt CA, Macintyre EA, van Dongen ... Arthritis Research & Therapy Vol 11 No Kappen et al in colonic tissue of < /b> a < /b> BD patient, IFN-γ, TNF-α, and IL-1 7A < /b> appear to be key cytokines, even in a < /b> treated patient Competing interests The < /b> authors...
  • 2
  • 306
  • 0

Xem thêm