construction of a full length cdna library from castor endosperm for high throughput functional screening
báo cáo khoa học: " An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library" ppsx
... Akiyama K, Oono Y, Muramatsu M, Hayashizaki Y, Kawai J, Carninci P, Itoh M, Ishii Y, Arakawa T, Shibata K, Shinagawa A, Shinozaki K: Functional annotation of a full- length Arabidopsis cDNA collection ... to manufacturer's protocol Consequently, a full- length cDNA library containing ~5 × 105 clones was obtained Sequencing of a full- length cDNA library For sequencing, the cDNA library was transferred ... functional analysis of the cDNA clones, we constructed an oriented fulllength cDNA library in a lambda vector that incorporated the Gateway cloning system The quality of this library was assessed...
- 9
- 286
- 0
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and resuspended into water Total cellular DNA was also alternatively isolated with QIAamp DNA Blood ... in length A TATA-box (TATAA) was located at nucleotides 83–87 and a poly (A) sequence ATTAAA at nucleotides 2978–2983 A GC-rich area was 107 nucleotides in length In the present study, two forms ... geminiviruses and plant circoviruses Arch Virol 143, 1723–1744 14 Okamoto H, Takahashi M, Nishizawa T, Tawara A, Sugai Y, Sai T, Tanaka T & Tsuda F (2000) Replicative forms of TT virus DNA in bone marrow...
- 12
- 446
- 0
báo cáo khoa học: " Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response" docx
... Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T, Nakajima M, Enju A, Akiyama K, Oono Y, Muramatsu M, Hayashizaki Y, Kawai J, Carninci P, Itoh M, Ishii Y, Arakawa T, Shibata K, Shinagawa A, ... M, Satou M, Sakurai T, Akiyama K, Iida K, Ishida J, Nakajima M, Enju A, Narusaka M, Fujita M, Oono Y, Kamei A, Yamaguchi-Shinozaki K, Shinozaki K: RIKEN Arabidopsis full- length (RAFL) cDNA and ... Izawa M, Nishi K, Kiyosawa H, Kondo S, Yamanaka I, Saito T, Okazaki Y, Gojobori T, Bono H, Kasukawa T, Saito R, Kadota K, Matsuda H, Ashburner M, Batalov S, Casavant T, Fleischmann W, Gaasterland...
- 17
- 220
- 0
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
... phrase we can extract that Z is likely a hypernym for both X and Y This data is extracted from the parsed text, and for each noun we construct a vector of hypernyms, with a value of i if a word ... looking at the nearest NP on each side of a particular NP Roark and Charniak (1998) built on that work by actually using conjunction and appositive data for noun clustering, as we here (They also ... a tremendous amount of memory With 50,000 nouns, we would initially require a 50,000 x 50,000 array of values (or a triangular array of about half this size) With our current hardware, the largest...
- 7
- 418
- 0
báo cáo khoa học: " A full-length enriched cDNA library and expressed sequence tag analysis of the parasitic weed, Striga hermonthica" pot
... Ishida J, Satou M, Sakurai T, Nakajima M, Enju A, Akiyama K, Oono Y, Muramatsu M, Hayashizaki Y, Kawai J, Carninci P, Itoh M, Ishii Y, Arakawa T, Shibata K, Shinagawa A, Shinozaki K: Functional annotation ... 8:448 Ogihara Y, Mochida K, Kawaura K, Murai K, Seki M, Kamiya A, Shinozaki K, Carninci P, Hayashizaki Y, Shin IT, Kohara Y, Yamazaki Y: Construction of a full- length cDNA library from young ... K, Kasuga M, Todaka D, Maruyama K, Nakashima K, Enju A, Mizukado S, Ahmed S, Yoshiwara K, Harada K, Tsubokura Y, Hayashi M, Sato S, Anai T, Ishimoto M, Funatsuki H, Teraishi M, Osaki M, Shinano...
- 10
- 252
- 0
Báo cáo khoa học: Solution structure and stability of the full-length excisionase from bacteriophage HK022 pot
... association/ aggregation upon interaction of Xis with specific DNA Spontaneous aspartate isomerization and deamidation of asparaginyl residues can serve as an initial site of spontaneous nonenzymatic ... molar heat capacity (solid line) and the best-fit partial molar heat capacity (dots) of HK022 Xis_wt The partial molar heat capacities of the Xis_wt native (CN) and denatured (C D ) states as ... intermediate of lambda Cro repressor J Mol Biol 255, 767–777 29 Makhatadze, G.I & Privalov, P.L (1990) Heat capacity of proteins I Partial molar heat capacity of individual amino acid residues in aqueous...
- 13
- 435
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...
- 10
- 696
- 0
báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot
... potential for use in early diagnosis and targeted therapy of RCC Materials Renal carcinoma line A4 98 and a normal renal cell line HK-2 were obtained from Medical Academy of China (Beijing, PR China) ... with advanced renal cell carcinoma Cancer Immun, 2007, 7: 13 14 Xu C, Lo A, Yammanuru A, Tallarico AS, Brady K, Murakami A, Barteneva N, Zhu Q, Marasco WA Unique biological properties of catalytic ... Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu1*§, Jintao Zhuang1*, Wenwei Wang1, Liang Zhao1, Liangyun Zhao1, Jiquan Zhao1,...
- 28
- 266
- 0
Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
... microarray-based comparison of ovarian tissues (theca cells, follicular granulose cells, total ovarian tissue, and ovarian connective tissue) from PCOS patients with ovarian tissues from healthy ... DNA-damage-inducible) alpha and beta, geminin, proliferating cell nuclear antigen, CDK6, and S-phase kinase associated protein isoform a; whilst SET translocation (myeloid leukemia-associated) is a multitasking ... syndrome such as PCOS Therefore, we constructed a dataset composed of information from microarray analyses and other genomic studies of PCOS patients This dataset, which consists of 1081 candidate genes,...
- 7
- 358
- 0
Báo cáo y học: "ilot Anopheles gambiae full-length cDNA study: sequencing and initial characterization of 35,575 clones" pps
... Y, Yoshitomo-Nakagawa K, Maruyama K, Suyama A, Sugano S: Construction and characterization of a full length- enriched and a 5'-end-enriched cDNA library Gene 1997, 200:149-156 Wheelan SJ, Church ... Imanishi T, Itoh T, Suzuki Y, O'Donovan C, Fukuchi S, Koyanagi KO, Barrero RA, Tamura T, Yamaguchi-Kabata Y, Tanino M, et al.: Integrative annotation of 21,037 human genes validated by fulllength ... be available there [10] Materials and methods Sequences were cleaned, clustered and assembled using the Paracel TranscriptAssembler software package (Paracel) Cleaning consisted of comparing cDNA...
- 11
- 402
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... 3¢) Amplification of RpCAbr and RpCAtr by quantitative PCR RpCAbrFqa TGG RpCAbrRqa GGT RpCAtrFqa GCC RpCAtrRqa TCA Full- length sequencing of RpCAbr RpCAbrF TAC RpCAbrR1 CGT RpCAbrR2 AGA RpCAbrR3 ... sequences have a H64 also shared by A gambiae, A aegypti, T gigas, D melanogaster-2 and D melanogaster-3 sequences (data not shown) By contrast, R pachyptila amino acid sequences not have any of these...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... atoms of Asp11 and Asn23 (Fig 3) in an arrangement similar to what is observed in VPRK Both PRK and VPRK have calcium bound at Ca3 SPRK also has an aspartic acid residue at position at 200, and ... autocatalytically cleaved off when the enzyme has obtained its active conformation, and the two C-terminal domains are cleaved off by heat treatment at 50 °C An Ala-Pro-Thr sequence is located ... initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced SPRK was compared with PRK and was found to be remarkable stable against...
- 11
- 551
- 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... hydrogen bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc (A2 ) a 1IC6 1THM 38 24 ⁄ ... whereas the overall exposed surface areas of the psychro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of larger area of apolar atoms, the meso- and ... uracil–DNA glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features Acta Crystallogr Sect D 59, 1357–1365 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... of AF499 was identified as an archaeal promoter element by sequence analysis The sequence AAAGGTTAATATA shows a high level of identity with the consensus sequence ()35 to )23, AAANNNTTATATA); ... the gel (lane B2) This behavior is typical of integral membrane proteins The polypeptide with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1) ... mass, cofactor content) Gene AF502 AF501 AF499 AF503 AF500 Apparent/calculated molecular mass Transmembrane helices Cofactor binding sites 53/64.4 kDa 34/38 kDa 31/30.5 kDa 16/16.7 kDa – /43 kDa None...
- 10
- 564
- 0
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt
... totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative for ... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... data from the surveys, data already available (e.g the 1-0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated provisionally, for...
- 30
- 520
- 0
Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx
... idea The C30 laccase isoforms we have detected so far all have an apparent molecular mass close to 65 kDa and, except for a still-uncharacterized laccase, are all acidic proteins with pI ranging ... activity of 934 UÆmg)1, for a final yield of 50% (Table 1) The pure LAC2 produced a single band both on a SDS/PAGE gel, at a molecular mass of approximately 65 kDa (Fig 1A) , and on a native PAGE gel ... speculated from steady state analysis that laccases have a conserved O2 binding domain and that the rate of O2 reduction is dependent on that of substrate oxidation In our case, this means that LAC2...
- 7
- 616
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Experimental procedures Ticks Adults of H longicornis obtained from the parthenogenetic Okayama strain maintained at the Laboratory of Parasitic Diseases, National Institute of Animal Health (Tsukuba, ... has a wide geographical distribution in Russia, eastern Asia, Australia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that ... 45 Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B, Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis...
- 14
- 432
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... bp) was PCR amplified from chromosomal DNA of P furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), ... 2-amino-3-oxobutyrate, which spontaneously decarboxylates to aminoacetone and CO2, or is cleaved in a CoA-dependent reaction by 2-amino-3-ketobutyrate coenzyme A lyase to glycine and acetyl-CoA Aminoacetone can ... 2-mercaptoethanol, 20% glycerol, pH 6.8) A broad range protein marker (Bio-Rad, Hercules, CA, USA) was used to estimate the molecular mass of the proteins Activity assays Rates of alcohol oxidation...
- 8
- 415
- 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and purification of the recombinant ... spoIIG amyR rA consensus r70 consensus TTAGACA TTAGACA TTGTACA TTGTTAC TTGTATT TTGACAG TTGTTTT TTGACA TTGACA 17 17 17 20 17 21 16 16–18 16–18 TTTG TTTG GTTG TATG TATG CTTG TGTG TNTG – TACAAT TACAAT ... alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction...
- 11
- 505
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25