... element abundance inA thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... tested The Athila elements are large, and our underestimate ofthe number of Athila elements resulted ina corresponding underestimate ofthe total amount of retrotransposon DNA intheA thaliana...
... the dramatic effects ofthe SG knockout on granular staining properties and storage of proteases, it was first important to determine whether the lack of SG affected the actual assembly of granules ... b-hexosaminidase is in uenced by SG Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a ... a plateau of maximal storage seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a...
... patellar and tibial cartilage was assessed The cartilage ofthe patella andthe tibia was isolated 3, 7, and 21 days after viral injection and incubated with 35SO42- for hours The proteoglycan synthesis ... visual investigation Therefore, the safranin O staining intensity was scored in patellar and tibial cartilage with a computerized imaging system There was a significant (30%) increase in safranin ... staining intensity inthe patella on day When the data of all time points were pooled, a significant increase in safranin O staining was observed The tibial cartilage, however, did not display...
... and other information that would help them gauge thequantitativeand qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial ... communities Clinicians working with their patients can facilitate meaningful quality assurance practices related to patient inclusion and exclusion, to data gathering, and to a nuanced awareness ofthe ... Explanatory and practical clinical trials: Two options for clinical trials in community settings [7,42] Explanatory clinical trials: Practical clinical trials: Hypothesis and design Hypothesis and...
... (SHA/GHA) are given in Table VI forthe main variables at the oldest ages available With one exception, standard errors are all lower than their parameter estimates andforthe majority of them, they ... significant differences except among females for branch angle in factorial and among males in factorial for branch density (Tab IV) For both traitsin factorial andfor branch angle only in factorial ... respectively for female and male components in factorial and 2.7% compared to 1.3 and 7.7% respectively for female and male components in factorial For branching, both Japanese and European larch clones...
... staining for RANKL in synovial cells andinthe infiltrating (inflammatory) cells (Fig 4h) There was a marked increase in RANKL expression, consistent with the increase in inflammatory cells and ... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids ... RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading front of bone erosions It has been long recognized that pro-inflammatory cytokines are intimately...
... central venous catheter was inserted into the femoral vein A 16-G arterial catheter was advanced into the descending aorta via the femoral artery A lateral cut-down was performed inthe cervical ... performance and cardiac loading conditions in an experimental model for acute PHT as well as in healthy animals with intact and pharmacologically blocked ANS Materials and methods This investigation ... forthe final study design, participated inthe animal experiments, supported the data acquisition andthe statistical analysis, and edited the final manuscript All authors read and approved the...
... superinfection, and therefore may affect the risk for pancreatic infection Time fora change For all ofthe above reasons, the beneficial effect of prophylactic antibiotics inthe ideal standardized setting ... patient truly at risk for infection and have a treatment modality that has no relevant side effects and that can be initiated ina timely fashion, theroleof antibiotics in patients with established ... performed Timely initiation of antibiotics is essential in pancreatic infection, just as in any other (intra-abdominal) infection Therefore, a low threshold for an aggressive diagnostic approach...
... Japanese [8], andthe Japanese version has been validated for use inthe general population of Japan [9], but the performance ofthe MHI-5 has not been evaluated in detail In addition, two ofthe ... performance ofthe MHI-5 andthe MHI-3 The AUC values are shown in Table 3, and other performance characteristics are shown in Table We also evaluated the performance of each ofthe MHI-5 question ... Setting and participants We used data that had been collected previously fora study ofthe validity ofthe Japanese version ofthe SF-36, and calculated national norm scores of all subscales of...
... syndromes and comparing against thresholds five times the standard deviation of syndrome values when only low levels of round-off error appear Thesimulation program randomly selects the line ina magnitude ... samples Burst and errors within each block are permitted A burst in this context means that the standard deviations of all components ina block are raised to 10% ofthe maximum standard deviation ... blocks of data over a wide range of variances are performed Forthe Figure Detection performance ofthe comparator versus threshold Hamidi et al EURASIP Journal on Advances in Signal Processing...
... respective sampling variances, obtained from the inverse ofthe average information matrix Using the estimated components of variance, approximations of additive genetic, dominance, epistatic and environˆ ... obtained by the square root ofthe respective sampling variances, and these were calculated from the sampling (co)variances ofthe components inthe denominator of equation (3) ˆ The standard ... considering that the trials are all measured at the i same age, assuming no G × E interaction and that no site is more representative ofthe plantation zone than any other For complete and balanced...
... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... groups The number of days of acute lung injury was decreased, however, and there was also a significant increase inthe cardiac index inthe NAC-treated group [20] Conclusions This is an exciting ... the sample size was small inthe extended case report [1], Hein and colleagues have made a significant contribution to our understanding ofthe important roleof antioxidant agents such as NAC...
... is capable of simulating the temporal and spatial variations of water pH (as an indicator of acidity), salinity and water flow ina coastal canal networks It was calibrated with the 2003-data and ... shows the advantages of considering land use and water salinity control before analyzing acidity generation and propagation for water quality management ina coastal area overlain with ASS The ... management, land uses of ASS and acidic pollution have led to a 70% reduction in income ofthe farmers living inthe ASS area of Ca Mau peninsula, a coastal area ofthe Mekong Delta of Vietnam On ASS,...
... distances between adjacent markers from all individual maps rescaled in Haldane unit The size and type ofthe mapping population are used to estimate the map accuracy and are integrated into the ... provide interesting targets for candidate gene approach andfor marker-assisted breeding [66] Meta-analysis could also be useful for comparative QTL mapping across widely related cropsof Page 12 of ... as described inthe original publication when available (interval length ofa certain LOD decrease) Otherwise, the confidence interval estimate was calculated with the empirical formula of Darvasi...
... Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (1999) Dual targeting property ofthe N-terminal signal sequence of P450 1A1 Targeting of heterologous proteins to ... in endogenous signalling pathways and environmental carcinogenesis Nat Rev Cancer 6, 947–960 Addya S, Anandatheerthavarada HK, Biswas G, Bhagwat SV, Mullick J & Avadhani NG (1997) Targeting of ... were initiated by the addition of mm NADPH, and incubation was continued for 30 at 37 °C ina shaking water bath The reactions were terminated by adding mL of ice-cold methanol, and insoluble particles...
... constant of eight was used forthe protein [39] A significant speed-up ofthe calculations was achieved by calculating pKa values for only a subset ofthe titratable groups inthe protein The subset ... substrate-binding, Asp142 moves into the ÔupÕ position and interacts with the substrate and Glu144 This rotation of Asp142 is accompanied by removal ofa water molecule and adjustments of Tyr10 and ... [26,29] The pKa calculations indicate that Glu144 has a slightly elevated pKa inthe free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate...
... essential for their growth taxis and their attachment to potato tuber The presence of Kdn might be characteristic ofplant pathogenic streptomycete strains causing scab diseases of potatoes and ... ester obtained upon alkaline hydrolysis of glucosylated ribitol teichoic acid from the cell wall of S azureus RIA 1009 [24] and based on the analysis ofthe products formed upon acid and enzymatic ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component ofthe cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis ofthe total cell wall preparation was determined...
... Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without ... permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without ... permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without...
... protocol using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense ... studies, carried out most ofthe assays and wrote the manuscript AK (Allard Kaptein) helped in conceiving the study and helped to draft the manuscript AK (Annemieke Kavelaars) and CH were involved in ... as the percentage [3H]-7α-OH-DHEA ofthe total amount of [3H]-label measured Results are expressed as the mean ± standard error ofthe mean of triplicate samples The data are representative of...