coercive force and dispersibility of magnetic particles for recording media
nvestigations of magnetic nanostructures for patterned media
... hysteresis loop of single layer and AFC media 52 Figure 3.4 SEM images of patterned media in (a) square lattice and (b) staggered lattice configuration for the dots size of 30 nm and a pitch of 50 nm ... Voltage (AHV) of (Co/Pd) conventional bit-patterned media with and 10 bilayers and capped bit-patterned media with 15 and 25 bi-layers 144 Figure 6.10 Magnetic Force Microscopy (MFM) images of (a) BPM1 ... illustration of three important layers for PMR media, respectively It can be seen that a magnetic recording layer (RL), a soft magnetic under layer, and intermediate layer are essential layers for PMR...
- 188
- 238
- 0
A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness
... for a much richer understanding of culture than heretofore envisaged by the majority of language teachers 2.2 Common approaches to the teaching of culture In the history of culture teaching different ... textbook among 23 the set of English textbooks for senior high school in Vietnam and the analysis of its cultural content may set an initial step for the analysis of the whole set of high school English ... of frequency and percentage of types of references to Vietnamese and foreign cultures according to Checklist One Types of reference Reference to Vietnamese culture Reference to foreign culture...
- 51
- 1,431
- 16
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 1 pptx
... Literature of interest CLADOCERANS, NEMATODES AND TROCHOPHORA LARVAE 6.1 Daphnia and Moina 6.1.1 Biology and life cycle of Daphnia 6.1.2 Nutritional value of Daphnia 6.1.3 Feeding and nutrition of Daphnia ... chapter For the industrial larviculture of fish and shellfish, readily and consistently available, practical and performing live diets need to be selected The selection of a suitable and nutritious ... permission of the copyright owner Applications for such permission, with a statement of the purpose and extent of the reproduction, should be addressed to the Director, Information Division, Food and...
- 15
- 790
- 2
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 2 doc
... function of the sampling, diluting, and filling of the counting chamber, as well as the choice of the right type of counting chamber and range of cell concentration Counting chambers, recommended for ... are free of any foreign organisms such as bacteria and require a strict sterilization of all glassware, culture media and vessels to avoid contamination The latter makes it impractical for commercial ... ponds of 10-40 tons of water volume and a water depth of 1.5-2 m 2.3.7 Culture of sessile micro-algae Farmers of abalone (Haliotis sp.) have developed special techniques to provide food for the...
- 45
- 654
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 3 ppt
... increase and not by cell division The epidermis contains a densely packed layer of keratin-like proteins and is called the lorica The shape of the lorica and the profile of the spines and ornaments ... adult female, Fig 3.17.), are ideal for storage and transport and can be used as inocula for mass cultures Mass production of rotifers for cyst production is performed in batch cultures in concrete ... generations of offspring before they eventually die The reproduction activity of Brachionus depends on the temperature of the environment as illustrated in Table 3.1 The life cycle of Brachionus...
- 30
- 553
- 1
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 4 pptx
... not only in terms of survival, growth and success of metamorphosis of many species of fish and crustaceans, but also with regard to their quality, e.g reduced incidence of malformations, improved ... expansion of aquaculture production in the 1970’s, the demand for Artemia cysts soon exceeded the offer and prices rose exponentially, turning Artemia into a bottleneck for the expansion of the ... habitats therefore require prior screening of candidate strains and of eventual local populations, as well as the study of prevailing environmental conditions Uncontrolled introduction of Artemia...
- 29
- 731
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 5 docx
... content and hatchability Hatchability of cysts is largely determined by the conditions and techniques applied for harvesting, cleaning, drying and storing of the cyst material The impact of most of ... hydration of the cysts (as complete removal of the envelope can only be performed when the cysts are spherical), removal of the brown shell in a hypochlorite solution, and washing and deactivation of ... function of the tank size and the density of cysts incubated Excessive foaming can be reduced by disinfection of the cysts prior to hatching incubation and/ or by the addition of a few drops of a...
- 29
- 791
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 6 docx
... fast harvesting of large volumes of Artemia nauplii and allows complete removal of debris from the hatching medium This technique results in a significant reduction of labour and production costs ... another, is often not critical for crustacean larvae, which can capture and tear apart food particles with their feeding appendages For marine fish larvae that have a very small mouth and swallow ... different amounts of EPA and yielding proportional results in growth and survival of Mysidopsis bahia shrimps fed these Artemia Levels of this EFA vary tremendously from strain to strain and even from...
- 26
- 567
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 7 pptx
... and attractive for the predators Table 4.4.3 Artificial seawater formulations used for tank production of Artemia (ing.l-1) For the Dietrich and Kalle formulation, solutions A and B are prepared ... evaluation of dry food is the consistency of the food quality and supply, and the possibility for storage without loss of quality It follows therefore that bulk products must be stored in a dry and ... behavior of Artemia by affecting the filtration rate, ingestion rate and/ or assimilation: including the quality and quantity of the food offered, the developmental stage of the larvae, and the...
- 33
- 579
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 8 pptx
... harvesting, e.g for 100 kg of adult biomass use a filter mouth of by m and a filter length of to m Figure 4.5.12 Raft with conical net used for Artemia biomass harvesting · use mesh size of to mm for selective ... the cysts and the relative humidity of the air For example, at a relative humidity of 70 to 75% cysts may reach a water content of about 10 to 15% after a maximum of 48 h, and drying for a longer ... are usually low and mainly fluctuate in function of food availability, temperature and salinity The size and/ or often complete absence of suitable infrastructure makes management of such lakes...
- 53
- 595
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 9 pptx
... 160 µm for larger rotifers, nauplius and copepodite stages of copepods; · 300 and 500 µm for small water fleas and smaller species of cyclopoid copepods; · 700 µm for adult water fleas of the ... structures that serve for suspension feeding (filter feeders) and for locomotion The anterior part of the trunk, the postabdomen is turned ventrally and forward and bears special claws and spines to ... V, 24 W and 20 rpm; 6) Submerged pump for the spray washing system (15 V and 60 W) with feed pipe to jets; 7) Recovery trough for washing water and plankton; 8) Filter sack for storage of concentrated...
- 30
- 542
- 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 10 pptx
... zooplankton, and copepods, nematodes and trochophores The document has been prepared to help meet the needs of aquaculture workers of member countries for the synthesis of information in the field of aquaculture ... individual food particles by taste) high concentrations of suspended material can interfere with the uptake of food particles Figure 6.1 Schematic drawing of the internal and external anatomy of Daphnia ... Production and use of resting eggs Resting eggs are interesting material for storage, shipment and starting of new Daphnia cultures The production of resting eggs can be initiated by exposing a part of...
- 15
- 531
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... hydrolysis and translocation [25] FA binds to a pocket between domains I, II and III of EF-G, and seems to lock EF-G in a conformation intermediate between the GTP-bound and GDP-bound forms [22] ... helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ribosome, and the four-stranded b-sheet ... type and various mutants, domains III, IV and V display a movement relative to domains I and II, resulting in a shift of the ˚ tip of domain IV of up to A [14,16] The ribosomebound structure of...
- 15
- 474
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... conditions for the production of the I7 OR in yeast and used biochemical and immunological methods to estimate the levels of receptor expression and its cellular localization Results Yeast transformations ... threshold concentration of · 10)8 m, and maximal amplitude for · 10)6 m As in the case of I7 OR, this curve is bell shaped, and finely tuned for helional concentrations between · 10)5 m and · 10)7 m In ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40...
- 14
- 473
- 0
Báo cáo " Classification and assessment of bioclimatic conditions for tourism, health resort and some weather therapies in Vietnam " pdf
... conditions for two ultimate purposes: (i) for the development of tourism, excursion and sea vacation activities in lowland areas; and (ii) for health resort and some weather therapies in highland areas ... daylight in lowland area in term of assessment for development of tourism activities as well as existence of fog during the daylight in highland in term of assessment for health resort and some weather ... conditions and these are the best places for human health in general and for tourism, excursion and sea vacation in particular Results and discussions The results of classification and assessment of...
- 8
- 510
- 0
Synthesis and Application of Nanosize Semiconductors for Photoxidation of Toxic Organic Chemicals pptx
... in both dispersed and heterogeneous forms (supported) tsnl Advantanges of this Approach•The light absorption and energy levels of the semiconductor valence and conduction bands can be adjusted ... with mixed sizes (bandedges and potentials) to optimize solar absorbance while still allowing a sufficient driving force for the photooxidation process •Examine the photooxidation of long-lived organics ... Se weak van-der-Waals forces :N bipyridine (bpy) :N Binding of substrate organic chemical occurs at metal edge sites Electron transfer rates allow an estimation of shift of the redox potential...
- 22
- 961
- 0
Synthesis and characterization of semiconducting nanowires for gas sensing
... image of a nanowire, and (e) linescan of the HAADF signal (solid line) and numerical fit of the shape of the nanowire (dashed line) As both composition and phase can be considered uniform for the ... useful for investigation of the termination of the nanowire lateral sides and apex Electron diffraction (ED) and analysis of zero-order and higher-order Laue-zones allows precise determination of ... center of an alumina tube and then temperature is raised above the limit of decomposition for the oxide (from 600 ◦ C for zinc oxide to 1500 ◦ C for indium oxide) [16] A controlled flow of inert...
- 6
- 662
- 0
preparation and properties of magnetic iron oxide nanotubes
... López-Urías, and Mu˜ oz-Sandoval (2005) n simulated the micromagnetic property of iron nanorings, and they found large coercive fields for din /dout > 0.5 (din and dout are the inner and outer diameters of ... value should be larger than 0.5 for single domain (SD) particles, between 0.1 and 0.5 for pseudosingle-domain (PSD) particles and lower than 0.1 for multidomain (MD) particles From Fig 5, both the ... spectra of samples S2 (a) and S3 (b) can be exclusively indexed to ␣-Fe2 O3 , according to standard data (JCPDS 33-0664) In Fig 1(b) and (c), the reflection peaks of XRD patterns of S2 and S3,...
- 6
- 552
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu