classically children with foreign bodies lodged in a bronchus or smaller airway have cough decreased breath sounds and ne
Báo cáo hóa học: " Oromotor variability in children with mild spastic cerebral palsy: a kinematic study of speech motor control" docx
... (utterance duration, peak opening displacement, and peak opening velocity) obtained by dividing the standard deviation of kinematic data by the mean kinematic data Larger CV indicates higher variability ... the examiner Data analysis Figure Experimental setup for kinematic analysis of speech tasks The reflective markers were attached to the facial mask and oral areas and reference coordination system ... HCC participated in the experimental setup of kinematic analysis, kinematic data collection and analysis, and revising of this manuscript WHH carried out the kinematic data collection and analysis...
- 10
- 421
- 0
Tài liệu Parental Attitude to Children with Sickle Cell Disease in Selected Health Facilities in Irepodun Local Government, Kwara State, Nigeria doc
... hospitalization and that the affected individuals or families suffer a burden of anxiety, frequent illness, excess mortality rates, ignorance and lack of appropriate health services and research Family ... explained that the general belief among Nigerians is that illness can be caused by natural, preternatural and mystical factors The preternatural explanation is related to the belief in witchcraft ... ante-natal diagnosis and its attendant risks, need for therapeutic abortion in case of an unfavorable genotype attendant risk, persistent state of anxiety and tension because the individual can get...
- 8
- 616
- 0
Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx
... categories are shown as means with ranges where appropriate Comparative data between characteristics are displayed, and data are summarized as tables as well as in text Results Patient characteristics ... mechanical ventilation It is probable that debilitating factors such as alcoholism or anemia are contributory Aspiration of sputum leading to aspiration pneumonia was a less common diagnosis in ... coupled with a lack of accurate, rapid and cost-effective diagnostic tests have posed a major obstacle to tuberculosis control in nations such as India (5) Among South East Asian nations India ranks...
- 6
- 506
- 0
Báo cáo khoa học: Local binding with globally distributed changes in a small protease inhibitor upon enzyme binding ppt
... dihedral rotations as they systematically compensate each other in neighboring residues resulting in a virtually unchanged main chain conformation (Fig S3) Analysis of NMR distance restraint violations ... residues classified as ‘scaffold’ Our findings indicate that inhibitors of the pacifastin family have a special design bringing together the dynamical features of peptides and structural organization, ... free inhibitors before titration was necessary Moreover, several resonances become unobservable or weak in the 1H–15N correlation (HSQC) spectra at near-neutral pH possibly indicating increased...
- 12
- 396
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" pot
... dysplasia of both acetabula, and severe osteoarthritis and subluxation of both hip joints On physical examination, the patient was small in stature (4ft 2in, 65lbs) and had obvious craniofacial abnormalities ... Specific facial anomalies may include hypertrichosis, prominent eyes and forehead (frontal bossing), megalocornea, blue sclerae, a flat nasal bridge, micrognathia, and anteverted nostrils [5,10] Neurologic ... A New Concept in the Treatment of Sacroiliac Joint Syndrome: A Preliminary Report of Four Cases Regional Anesthesia and Pain Medicine 1999, 24(1):84-88 17 Itokazu M, Matsunaga T: Clinical Evaluation...
- 5
- 462
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" ppt
... dysplasia of both acetabula, and severe osteoarthritis and subluxation of both hip joints On physical examination, the patient was small in stature (4ft 2in, 65lbs) and had obvious craniofacial abnormalities ... Specific facial anomalies may include hypertrichosis, prominent eyes and forehead (frontal bossing), megalocornea, blue sclerae, a flat nasal bridge, micrognathia, and anteverted nostrils [5,10] Neurologic ... A New Concept in the Treatment of Sacroiliac Joint Syndrome: A Preliminary Report of Four Cases Regional Anesthesia and Pain Medicine 1999, 24(1):84-88 17 Itokazu M, Matsunaga T: Clinical Evaluation...
- 5
- 393
- 0
Báo cáo y học: "Psychogenic or neurogenic origin of agrammatism and foreign accent syndrome in a bipolar patient: a case report" pdf
... a habitual or more automatic response in favour of an unusual one), was influenced by interference He obtained normal scores in the word reading and colour naming but his performance was impaired ... he was on stable doses of lithium, valproate, quetiapine and perphenazine Although they appeared approximately years earlier, the functional origin of the FAS and agrammatism was explored in FG ... there are no instances of FAS and agrammatism previously reported in a bipolar patient Case presentation FG is a 74-year-old right-handed man He has a grade eleven education and worked as an auxiliary...
- 7
- 502
- 0
Báo cáo khoa học: "Pathological complete response induced by first-line chemotherapy with single agent docetaxel in a patient with advanced non small cell lung cancer" pptx
... authors declare that they have no competing interests Author details UOC Oncologia, Ospedale Cardarelli, Napoli, Italy 2UOC Chirurgia Toracica, Ospedale Cardarelli, Napoli, Italy 3UOC Anatomia Patologica, ... regarding neo-adjuvant docetaxel-based chemotherapy in other inoperable malignant tumors, such as breast cancer[8] Surprisingly, a complete pathologic response was not obtained with a platinum-based ... had a more favorable toxicity profile than patients treated with DC In particular, there were important differences in the incidence of: (a) grade anemia, (b) grade 3/4 nausea/ vomiting, diarrhea,...
- 4
- 303
- 0
báo cáo khoa học: "Chest pain with ST segment elevation in a patient with prosthetic aortic valve infective endocarditis: a case report" ppsx
... urokinase Cathet Cardiovasc Diagn 1998, 43:457-459 Kiernan TJ, Flynn AMO, Kearney P: Coronary embolism causing myocardial infarction in a patient with mechanical aortic valve prosthesis Int J Cardiol ... tissue aortic valve Vancomycin, Gentamicin and Rifampicin were given under microbiology guidance Five days later, our patient became more unwell, and was found to be in worsening cardiac failure A ... in a patient with prosthetic aortic valve infective endocarditis: a case report Vishal Luther1*, Refai Showkathali2 and Reto Gamma2 Abstract Introduction: Acute ST-segment elevation myocardial...
- 4
- 184
- 0
báo cáo khoa học: " Thin anterior uterine wall with incomplete uterine rupture in a primigravida detected by palpation and ultrasound: a case report" pptx
... wall was thin and a fetal hand and head were visible through it (Figure 2A and 2B) A transverse incision was made cephalad to this thin wall area, and a 2604 g (appropriate-for-date Figure An abdominal ... abdominal ultrasound image of the uterine wall and the fetal minor part The small arrow indicates a thin uterine wall, which is slightly bulging Beneath the thin uterine wall a fetal minor part ... (large arrow) is visible, which was palpated as a hard mass through the abdomen Page of according to the Japanese standard) female baby was delivered with Apgar scores of and at one to five minutes,...
- 4
- 310
- 0
báo cáo khoa học: " Acquired A amyloidosis from injection drug use presenting with atraumatic splenic rupture in a hospitalized patient: a case report" potx
... murmur radiating to the apex and to the carotid arteries An abdominal examination revealed a distended abdomen and tenderness to palpation in the left upper quadrant A computed tomography (CT) scan ... of our patient and oversaw manuscript preparation and revision All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... from systemic AA amyloidosis Conclusion Patients with a history of ‘skin popping’, especially with black tar heroin, are at risk for AA amyloidosis In patients with chronic inflammatory conditions...
- 6
- 209
- 0
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... life-threatening complication of PEG-IFNa 2a treatment Abbreviations AA: aplastic anemia; AIHA: autoimmune hemolytic anemia; EBV: Epstein-Barr virus; HAA: hepatitis-associated aplastic anemia; Hb: ... hypogammaglobulinemia or abnormal bands A computed tomography examination of the patient’s abdomen and thorax was unremarkable The patient’s bone marrow biopsy was profoundly hypocellular with a ... nausea, anorexia, diarrhea, psychiatric symptoms, alopecia, injection-site reactions, leukopenia, thrombocytopenia, hemolytic anemia, cough, dyspnea, rash, pruritus, insomnia, and ataxia, have...
- 5
- 352
- 0
Báo cáo y học: "Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case repor" ppt
... this case report Anodyne was used, but there are other similar devices available for healthcare providers Anodyne is FDA approved for increasing circulation and reducing pain, and it has been ... FDAapproved drugs on the market for the treatment of RLS Now ropinirole and pramipexole, both dopamine agonists, are available Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and ... mg (Ambien) She also reported having been diagnosed with depression and had taken 20 mg fluoxetine (Prozac) daily for almost 25 years Our patient never made a connection or noticed a correlation...
- 5
- 318
- 0
Báo cáo y học: " Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case report" docx
... this case report Anodyne was used, but there are other similar devices available for healthcare providers Anodyne is FDA approved for increasing circulation and reducing pain, and it has been ... FDAapproved drugs on the market for the treatment of RLS Now ropinirole and pramipexole, both dopamine agonists, are available Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and ... mg (Ambien) She also reported having been diagnosed with depression and had taken 20 mg fluoxetine (Prozac) daily for almost 25 years Our patient never made a connection or noticed a correlation...
- 5
- 227
- 0
Báo cáo y học: "Recurrent acute myocardial infarction with coronary artery aneurysm in a patient with Behçet’s disease: a case report" ppsx
... in 2004 and had been taking warfarin but had discontinued the medication Medical examination revealed blood pressure of 130/70mmHg and heart rate of 85 beats/minute and the patient was pale and ... fibrosis and thus weakens and predisposes the arterial wall to aneurysm formation that eventually ruptures [9] In our patient, angiography was performed for evaluation of coronary anatomy Coronary angiograms ... elevation on precordial leads Laboratory tests showed elevation of plasma total CK and CK-MB activities This time, a new anterior myocardial infarction was diagnosed, medical treatment was started...
- 4
- 290
- 0
báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc
... with an extra band as intense as the major bands were found among 39 siblings in the Kov45 family and 20 individuals with an extra band slightly fainter than the major bands were found among ... TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding regions were determined for the maternal plants and a few representative progeny from each family ... organellar markers Three individuals were identified that differed from their siblings and maternal parents in mt DNA haplotypes For instance, individuals in lanes 2, 4, and in figure are siblings...
- 11
- 163
- 0
Báo cáo y học: "Cost effectiveness of community-based therapeutic care for children with severe acute malnutrition in Zambia: decision tree model" pptx
... were trained to diagnose SAM in children under years of age, by measuring mid upper arm circumference (MUAC) and examining children for bilateral pedal pitting oedema SAM was defined as MUAC of ... Programme data Programme data Programme data Programme data LDMHT SE assumed Valid International SE assumed Programme data LDMHT SE assumed Valid International SE assumed [24] SE assumed UTH data ... epidemic, and UNICEF estimates indicate that under five mortality rates in Zambia remained constant between 1990 and 2006 [31] Although comparable mortality rates were not available for children with...
- 9
- 315
- 0
Báo cáo y học: "Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of treatment, number of clinical contacts and referrals to surgery" pdf
... patients with dominating leg pain often have a longer course of treatment and a worse prognosis than those with mainly back pain, those with leg pain were initially analyzed separately on Discussion ... group The same information was collected as for the “routine MRI” group, together with information about referral for MRI Variables of interest The following baseline variables were obtained from ... R, Carrino JA, Deyo RA: Imaging strategies for low-back pain: systematic review and meta-analysis Lancet 2009, 373:463-472 Jarvik JG, Deyo RA: Diagnostic evaluation of low back pain with emphasis...
- 5
- 351
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... acidcontaining peptide analogues Symbols are the experimental results obtained with data in Table Dotted lines represent theoretical values obtained from equations previously determined with 53 (A) and ... AMBER forcefield Table S2 Minimum-energy conformers of Ac-b2-HAlaNHMe obtained with DISCOVER and AMBER forcefield Table S3 Minimum-energy conformers of Ac-b3-HAlaNHMe obtained with DISCOVER and AMBER ... and w and were subsequently refined by varying /, w angles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10° Each /, h, and w-value was fixed by applying a harmonic potential and...
- 11
- 860
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25